ZNF644 (NM_016620) Human Untagged Clone
CAT#: SC311685
ZNF644 (untagged)-Human zinc finger protein 644 (ZNF644), transcript variant 2
CNY 3,990.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | BM-005; MYP21; NatF; ZEP-2 |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_016620, the custom clone sequence may differ by one or more nucleotides
ATGTTAATAAGACAAAATCTAGCCTTAGATTGTAAGCAAAAGAAATCAAGGTCAAGATCT GGAAGCAAGAAGAAAATGCTAACATTACCTCATGGTGCTGACGAGGTTTACATTCTCCGA TGCAGGTTTTGTGGCCTAGTCTTTCGAGGACCCTTGTCTGTTCAGGAAGACTGGATTAAG CACTTACAACGACATATTGTAAACGCTAATCTTCCACGGACTGGAGCTGGCATGGTGGAA GTCACGTCACTACTTAAAAAGCCTGCCTCCATTACAGAAACTTCATTTTCTCTACTAATG GCCGAAGCAGCTTCA |
Restriction Sites | Please inquire |
ACCN | NM_016620 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_016620.2, NP_057704.2 |
RefSeq Size | 2085 bp |
RefSeq ORF | 318 bp |
Locus ID | 84146 |
UniProt ID | Q9H582 |
Domains | zf-C2H2 |
Protein Families | Transcription Factors |
Gene Summary | The protein encoded by this gene is a zinc finger transcription factor that may play a role in eye development. Defects in this gene have been associated with high myopia. Three transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Aug 2011] Transcript Variant: This variant (3) differs in the 5' UTR and lacks two alternate in-frame exons compared to variant 1. The resulting isoform (2) has the same N- and C-termini but is shorter compared to isoform 1. Variants 2 and 3 both encode isoform 2. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC223480 | ZNF644 (Myc-DDK-tagged)-Human zinc finger protein 644 (ZNF644), transcript variant 2 |
CNY 3,990.00 |
|
RC223480L3 | Lenti-ORF clone of ZNF644 (Myc-DDK-tagged)-Human zinc finger protein 644 (ZNF644), transcript variant 2 |
CNY 5,890.00 |
|
RC223480L4 | Lenti-ORF clone of ZNF644 (mGFP-tagged)-Human zinc finger protein 644 (ZNF644), transcript variant 2 |
CNY 5,890.00 |
|
RG223480 | ZNF644 (tGFP-tagged) - Human zinc finger protein 644 (ZNF644), transcript variant 2 |
CNY 4,370.00 |