HMGA1 (NM_145903) Human Untagged Clone

CAT#: SC311577

HMGA1 (untagged)-Human high mobility group AT-hook 1 (HMGA1), transcript variant 5



  "NM_145903" in other vectors (4)

CNY 3,990.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
Anti-HMGA1 Rabbit Polyclonal Antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms HMG-R; HMGA1A; HMGIY
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC311577 representing NM_145903.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGAGTGAGTCGAGCTCGAAGTCCAGCCAGCCCTTGGCCTCCAAGCAGGAAAAGGACGGCACTGAGAAG
CGGGGCCGGGGCAGGCCGCGCAAGCAGCCTCCGAAGGAGCCCAGCGAAGTGCCAACACCTAAGAGACCT
CGGGGCCGACCAAAGGGAAGCAAAAACAAGGGTGCTGCCAAGACCCGGAAAACCACCACAACTCCAGGA
AGGAAACCAAGGGGCAGACCCAAAAAACTGGAGAAGGAGGAAGAGGAGGGCATCTCGCAGGAGTCCTCG
GAGGAGGAGCAGTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_145903
Insert Size 291 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_145903.2
RefSeq Size 1884 bp
RefSeq ORF 291 bp
Locus ID 3159
UniProt ID P17096
Protein Families Druggable Genome, Stem cell - Pluripotency, Stem cell relevant signaling - JAK/STAT signaling pathway, Transcription Factors
MW 10.7 kDa
Gene Summary This gene encodes a chromatin-associated protein involved in the regulation of gene transcription, integration of retroviruses into chromosomes, and the metastatic progression of cancer cells. The encoded protein preferentially binds to the minor groove of AT-rich regions in double-stranded DNA. Multiple transcript variants encoding different isoforms have been found for this gene. Pseudogenes of this gene have been identified on multiple chromosomes. [provided by RefSeq, Jan 2016]
Transcript Variant: This variant (5) lacks an exon in the 5' UTR and uses an alternate in-frame splice site compared to variant 1. It encodes isoform b (also called HMG-Y), which is shorter than isoform a. Variants 2, 4, 5, 7, and 8 encode the same isoform (b). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...