United States
Germany
Japan
United Kingdom
China
FGF1 (NM_033137) Human Untagged Clone
CAT＃: SC311521
FGF1 (untagged)-Human fibroblast growth factor 1 (acidic) (FGF1), transcript variant 3
CNY 3,990.00
Product images
CNY 1,999.00
CNY 2,700.00
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | AFGF; ECGF; ECGF-beta; ECGFA; ECGFB; FGF-1; FGF-alpha; FGFA; GLIO703; HBGF-1; HBGF1 |
| Vector | pCMV6 series |
| Sequence Data |
>NCBI ORF sequence for NM_033137, the custom clone sequence may differ by one or more nucleotides
ATGGCTGAAGGGGAAATCACCACCTTCACAGCCCTGACCGAGAAGTTTAATCTGCCTCCA GGGAATTACAAGAAGCCCAAACTCCTCTACTGTAGCAACGGGGGCCACTTCCTGAGGATC CTTCCGGATGGCACAGTGGATGGGACAAGGGACAGGAGCGACCAGCACAACACCAAA |
| Restriction Sites | Please inquire |
| ACCN | NM_033137 |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_033137.1, NP_149128.1 |
| RefSeq Size | 2250 bp |
| RefSeq ORF | 180 bp |
| Locus ID | 2246 |
| Domains | FGF |
| Protein Families | Druggable Genome, Secreted Protein |
| Protein Pathways | MAPK signaling pathway, Melanoma, Pathways in cancer, Regulation of actin cytoskeleton |
| Gene Summary | The protein encoded by this gene is a member of the fibroblast growth factor (FGF) family. FGF family members possess broad mitogenic and cell survival activities, and are involved in a variety of biological processes, including embryonic development, cell growth, morphogenesis, tissue repair, tumor growth and invasion. This protein functions as a modifier of endothelial cell migration and proliferation, as well as an angiogenic factor. It acts as a mitogen for a variety of mesoderm- and neuroectoderm-derived cells in vitro, thus is thought to be involved in organogenesis. Multiple alternatively spliced variants encoding different isoforms have been described. [provided by RefSeq, Jan 2009] Transcript Variant: This variant (3) uses an alternate splice site and lacks a coding exon in the coding region, which results in a frameshift, compared to variant 1. The encoded isoform (3) is shorter and has a distinct C-terminus, compared to isoform 1. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC214005 | FGF1 (Myc-DDK-tagged)-Human fibroblast growth factor 1 (acidic) (FGF1), transcript variant 3 |
CNY 3,990.00 |
|
| RC214005L3 | Lenti-ORF clone of FGF1 (Myc-DDK-tagged)-Human fibroblast growth factor 1 (acidic) (FGF1), transcript variant 3 |
CNY 5,890.00 |
|
| RC214005L4 | Lenti-ORF clone of FGF1 (mGFP-tagged)-Human fibroblast growth factor 1 (acidic) (FGF1), transcript variant 3 |
CNY 5,890.00 |
|
| RG214005 | FGF1 (tGFP-tagged) - Human fibroblast growth factor 1 (acidic) (FGF1), transcript variant 3 |
CNY 4,370.00 |
