United States
Germany
Japan
United Kingdom
China
FBXO4 (NM_033484) Human Untagged Clone
CAT＃: SC311466
FBXO4 (untagged)-Human F-box protein 4 (FBXO4), transcript variant 2
CNY 6,270.00
| Cited in 1 publication. |
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | FBX4 |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>SC311466 representing NM_033484.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGGCGGGAAGCGAGCCGCGCAGCGGAACAAACTCGCCGCCGCCGCCCTTCAGCGACTGGGGCCGCCTG GAGGCGGCCATCCTCAGCGGCTGGAAGACCTTCTGGCAGTCAGTGAGCAAGGAGAGGGTGGCGCGTACG ACCTCACGGGAGGAGGTGGATGAGGCGGCCAGCACCCTGACGCGGCTGCCGATTGATGTACAGCTATAT ATTTTGTCCTTTCTTTCACCTCATGATCTGTGTCAGTTGGGAAGTACAAATCATTATTGGAATGAAACT GTAAGAGATCCAATTCTGTGGAGATACTTTTTGTTGAGGGATCTTCCTTCTTGGTCTTCTGTTGACTGG AAGTCTCTTCCAGATCTAGAAATCTTAAAAAAGCCTATATCTGAGGTCACTGATGGTGCATTTTTTGAC TACATGGCAGTCTATAGAATGTGCTGTCCATACACAAGAAGAGCTTCAAAATCCAGCCGTCCTATGTAT GGAGCTGTCACTTCTTTTTTACACTCCCTGATCATTCAGAATGAACCACGATTTGCTATGTTTGGACCA GGTTTGGAAGAATTGAATACCTCTTTGGTGTTGAGCTTGATGTCTTCAGAGGAACTTTGCCCAACAGCT GGTTTGCCTCAGAGGCAGATTGATGGTATTGGATCAGGAGTCAATTTTCAGTTGAACAACCAACATAAA TTCAACATTCTAATCTTATATTCAACTACCAGAAAGGAAAGAGATAGAGCAAGGGAAGAGCATACAAGT GCAGTTAACAAGATGTTCAGTCGACACAATGAAGGTGATGATCAACAAGGAAGCCGGTACAGTGTGATT CCACAGATTCAAAAAGTGTGTGAAGTTGTAGATGGGTTCATCTATGTTGCAAATGCTGAAGCTCATAAA AGTAAGTACTCATATGTACATTTTTAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_033484 |
| Insert Size | 924 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_033484.2 |
| RefSeq Size | 1745 bp |
| RefSeq ORF | 924 bp |
| Locus ID | 26272 |
| UniProt ID | Q9UKT5 |
| Domains | F-box |
| Protein Families | Druggable Genome |
| Protein Pathways | Ubiquitin mediated proteolysis |
| MW | 35 kDa |
| Gene Summary | This gene encodes a member of the F-box protein family which is characterized by an approximately 40 amino acid motif, the F-box. The F-box proteins constitute one of the four subunits of the ubiquitin protein ligase complex called SCFs (SKP1-cullin-F-box), which function in phosphorylation-dependent ubiquitination. The F-box proteins are divided into 3 classes: Fbws containing WD-40 domains, Fbls containing leucine-rich repeats, and Fbxs containing either different protein-protein interaction modules or no recognizable motifs. The protein encoded by this gene belongs to the Fbxs class. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2014] Transcript Variant: This variant (2) lacks two exons and its transcription extends past a splice site that is used in variant 1, resulting in a novel 3' coding region and 3' UTR compared to variant 1. It encodes isoform 2 which is shorter and has a distinct C-terminus, compared to isoform 1. |
Citations (1)
| The use of this cDNA Clones has been cited in the following citations: |
|---|
|
PinX1 Localizes to Telomeres and Stabilizes TRF1 at Mitosis
,Tohru Yonekawa, Shuqun Yang, and Christopher M. Counter,
Mol. Cell. Biol., Apr 2012; 32: 1387 - 1395.
[FBXO4]
|
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC222474 | FBXO4 (Myc-DDK-tagged)-Human F-box protein 4 (FBXO4), transcript variant 2 |
CNY 2,400.00 |
|
| RC222474L3 | Lenti-ORF clone of FBXO4 (Myc-DDK-tagged)-Human F-box protein 4 (FBXO4), transcript variant 2 |
CNY 5,890.00 |
|
| RC222474L4 | Lenti-ORF clone of FBXO4 (mGFP-tagged)-Human F-box protein 4 (FBXO4), transcript variant 2 |
CNY 5,890.00 |
|
| RG222474 | FBXO4 (tGFP-tagged) - Human F-box protein 4 (FBXO4), transcript variant 2 |
CNY 4,370.00 |
