EMA (MUC1) (NM_001044391) Human Untagged Clone
CAT#: SC311446
MUC1 (untagged)-Human mucin 1, cell surface associated (MUC1), transcript variant 6
CNY 3,990.00
Product images
CNY 1,999.00
CNY 2,700.00
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | ADMCKD; ADMCKD1; ADTKD2; CA 15-3; CD227; EMA; H23AG; KL-6; MAM6; MCD; MCKD; MCKD1; MUC-1; MUC-1/SEC; MUC-1/X; MUC1/ZD; PEM; PEMT; PUM |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC311446 representing NM_001044391.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGACACCGGGCACCCAGTCTCCTTTCTTCCTGCTGCTGCTCCTCACAGTGCTTACAGTTGTTACGGGT TCTGGTCATGCAAGCTCTACCCCAGGTGGAGAAAAGGAGACTTCGGCTACCCAGAGAAGTTCAGTGCCC AGCTCTACTGAGAAGAATGCTTTTAATTCCTCTCTGGAAGATCCCAGCACCGACTACTACCAAGAGCTG CAGAGAGACATTTCTGAAATGGCTGTCTGTCAGTGCCGCCGAAAGAACTACGGGCAGCTGGACATCTTT CCAGCCCGGGATACCTACCATCCTATGAGCGAGTACCCCACCTACCACACCCATGGGCGCTATGTGCCC CCTAGCAGTACCGATCGTAGCCCCTATGAGAAGGTTTCTGCAGGTAATGGTGGCAGCAGCCTCTCTTAC ACAAACCCAGCAGTGGCAGCCACTTCTGCCAACTTGTAG ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_001044391 |
Insert Size | 453 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001044391.2 |
RefSeq Size | 851 bp |
RefSeq ORF | 453 bp |
Locus ID | 4582 |
UniProt ID | P15941 |
Protein Families | Druggable Genome, Secreted Protein, Transmembrane |
MW | 16.3 kDa |
Gene Summary | This gene encodes a membrane-bound protein that is a member of the mucin family. Mucins are O-glycosylated proteins that play an essential role in forming protective mucous barriers on epithelial surfaces. These proteins also play a role in intracellular signaling. This protein is expressed on the apical surface of epithelial cells that line the mucosal surfaces of many different tissues including lung, breast stomach and pancreas. This protein is proteolytically cleaved into alpha and beta subunits that form a heterodimeric complex. The N-terminal alpha subunit functions in cell-adhesion and the C-terminal beta subunit is involved in cell signaling. Overexpression, aberrant intracellular localization, and changes in glycosylation of this protein have been associated with carcinomas. This gene is known to contain a highly polymorphic variable number tandem repeats (VNTR) domain. Alternate splicing results in multiple transcript variants.[provided by RefSeq, Feb 2011] Transcript Variant: This variant (6) has multiple differences but maintains the reading frame, compared to variant 1. These differences result in a shorter isoform (6), compared to isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC223848 | MUC1 (Myc-DDK-tagged)-Human mucin 1, cell surface associated (MUC1), transcript variant 6 |
CNY 1,200.00 |
|
RC223848L1 | Lenti ORF clone of Human mucin 1, cell surface associated (MUC1), transcript variant 6, Myc-DDK-tagged |
CNY 3,600.00 |
|
RC223848L2 | Lenti ORF clone of Human mucin 1, cell surface associated (MUC1), transcript variant 6, mGFP tagged |
CNY 5,890.00 |
|
RC223848L3 | Lenti ORF clone of Human mucin 1, cell surface associated (MUC1), transcript variant 6, Myc-DDK-tagged |
CNY 5,890.00 |
|
RC223848L4 | Lenti ORF clone of Human mucin 1, cell surface associated (MUC1), transcript variant 6, mGFP tagged |
CNY 5,890.00 |
|
RG223848 | MUC1 (tGFP-tagged) - Human mucin 1, cell surface associated (MUC1), transcript variant 6 |
CNY 4,370.00 |