S100A7L2 (NM_001045479) Human Untagged Clone
CAT#: SC311438
S100A7L2 (untagged)-Human S100 calcium binding protein A7-like 2 (S100A7L2)
CNY 3,990.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | S100a7b |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC311438 representing NM_001045479.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGCTTCCCAGCTCTGGCTTTTTGAAAGCAAAGATGAATATCCCTCTAGGTGAGAAAGTCATGTTGGAC ATAGTCGCGATGTTTCGCCAATACAGTGGAGATGATGGTAGGATGGACATGCCAGGTCTGGTGAACTTG ATGAAGGAGAACTTCCCCAACTTCCTCAGTGGCTGTGAAAAAAGCGACATGGATTACTTGTCCAATGCC CTTGAGAAAAAAGATGATAATAAGGATAAGAAGGTTAATTATTCTGAGTTTCTTTCCTTGCTGGGGGAT ATAACCATAGACCACCACAAGATAATGCATGGAGTGGCACCCTGTTCCGGGGGAAGCCAGTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_001045479 |
Insert Size | 339 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001045479.1 |
RefSeq Size | 480 bp |
RefSeq ORF | 339 bp |
Locus ID | 645922 |
MW | 12.5 kDa |
Gene Summary | This locus is currently categorized as a non-transcribed pseudogene, but the locus type of this gene is unclear since it does contain an intact CDS. This locus lacks evidence indicating that it is transcribed, and very little of the upstream regions found in other family members are present at this locus. [provided by RefSeq, May 2018] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC223024 | S100A7L2 (Myc-DDK-tagged)-Human S100 calcium binding protein A7-like 2 (S100A7L2) |
CNY 1,200.00 |
|
RC223024L3 | Lenti ORF clone of Human S100 calcium binding protein A7-like 2 (S100A7L2), Myc-DDK-tagged |
CNY 5,890.00 |
|
RC223024L4 | Lenti ORF clone of Human S100 calcium binding protein A7-like 2 (S100A7L2), mGFP tagged |
CNY 5,890.00 |
|
RG223024 | S100A7L2 (tGFP-tagged) - Human S100 calcium binding protein A7-like 2 (S100A7L2) |
CNY 4,370.00 |
其它S100A7L2产品