SDHAF1 (NM_001042631) Human Untagged Clone
CAT#: SC311341
SDHAF1 (untagged)-Human succinate dehydrogenase complex assembly factor 1 (SDHAF1), nuclear gene encoding mitochondrial protein
CNY 1,800.00
Cited in 1 publication. |
Product images
CNY 1,999.00
CNY 2,700.00
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | LYRM8; MC2DN2 |
Vector | pCMV6-XL4 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>OriGene sequence for NM_001042631 edited
GGCTCCGCGGTTCGCAGGTCGTTCGCTGAGCGTCTCTGCTTAGCCGCGGTCATGAGCCGG CACAGCCGGCTGCAGAGGCAGGTTCTGAGCCTGTACCGCGATCTGCTGCGCGCCGGGCGT GGGAAGCCGGGCGCCGAGGCGCGAGTGCGGGCAGAGTTCCGGCAGCATGCGGGCCTGCCG CGGTCCGACGTGCTGCGCATCGAGTACCTGTACCGCCGCGGGCGGCGCCAGCTGCAGCTG CTACGCTCGGGCCACGCCACCGCCATGGGCGCCTTCGTACGCCCGCGGGCCCCGACCGGG GAGCCTGGCGGCGTGGGTTCCCAGCCTGACGACGGCGACAGTCCAAGGAACCCCCACGAC AGCACGGGGGCACCGGAGACCCGCCCCGACGGACGGTGACAGGCGAAGAGCCGAACTCGC TCGATGGCGTGGTGGAGCCAGGAGGCTCGCCTGACTGCATGGGGGGACTGGGGAACCCGC CTAAGGTGAGAGGTCTTAAGAGACTAGCTTGACGAATTGGGGATGTCAGAGACTCCTCCT TGGCGACGCAGGGGGCCTAGAGAGCCCCGTGATGGACGGCAAGGGAGGCCCGCCTTTTCC GATGCTTGGAGACAGGTCGGTGCTCCTCCCCCATGAGGGCTTGGGGCGGCCTGGGACGCT GGCGGGCTGGACAGT |
Restriction Sites | Please inquire |
ACCN | NM_001042631 |
Insert Size | 1200 bp |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001042631.1, NP_001036096.1 |
RefSeq Size | 1131 bp |
RefSeq ORF | 348 bp |
Locus ID | 644096 |
UniProt ID | A6NFY7 |
Gene Summary | The succinate dehydrogenase (SDH) complex (or complex II) of the mitochondrial respiratory chain is composed of 4 individual subunits. The protein encoded by this gene resides in the mitochondria, and is essential for SDH assembly, but does not physically associate with the complex in vivo. Mutations in this gene are associated with SDH-defective infantile leukoencephalopathy (mitochondrial complex II deficiency).[provided by RefSeq, Mar 2010] |
Citations (1)
The use of this cDNA Clones has been cited in the following citations: |
---|
Mitochondrial complex II is a source of the reserve respiratory capacity that is regulated by metabolic sensors and promotes cell survival
,Pfleger, J;He, M;Abdellatif, M;,
Cell Death Dis
,PubMed ID 26225774
[SDHAF1]
|
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC216831 | SDHAF1 (Myc-DDK-tagged)-Human succinate dehydrogenase complex assembly factor 1 (SDHAF1), nuclear gene encoding mitochondrial protein |
CNY 1,800.00 |
|
RC216831L1 | Lenti ORF clone of Human succinate dehydrogenase complex assembly factor 1 (SDHAF1), nuclear gene encoding mitochondrial protein, Myc-DDK-tagged |
CNY 4,200.00 |
|
RC216831L2 | Lenti ORF clone of Human succinate dehydrogenase complex assembly factor 1 (SDHAF1), nuclear gene encoding mitochondrial protein, mGFP tagged |
CNY 5,890.00 |
|
RC216831L3 | Lenti ORF clone of Human succinate dehydrogenase complex assembly factor 1 (SDHAF1), nuclear gene encoding mitochondrial protein, Myc-DDK-tagged |
CNY 5,890.00 |
|
RC216831L4 | Lenti ORF clone of Human succinate dehydrogenase complex assembly factor 1 (SDHAF1), nuclear gene encoding mitochondrial protein, mGFP tagged |
CNY 5,890.00 |
|
RG216831 | SDHAF1 (tGFP-tagged) - Human succinate dehydrogenase complex assembly factor 1 (SDHAF1), nuclear gene encoding mitochondrial protein |
CNY 4,370.00 |