United States
Germany
Japan
United Kingdom
China
ABHD12 (NM_001042472) Human Untagged Clone
CAT＃: SC311263
ABHD12 (untagged)-Human abhydrolase domain containing 12 (ABHD12), transcript variant 1
CNY 3,656.00
CNY 6,460.00
| Cited in 1 publication. |
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | ABHD12A; BEM46L2; C20orf22; dJ965G21.2; hABHD12; PHARC |
| Vector | pCMV6-XL5 |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | None |
| Sequence Data |
>OriGene sequence for NM_001042472 edited
ATGAGGAAGCGGACCGAGCCCGTCGCCTTGGAGCATGAGCGCTGCGCCGCCGCGGGCTCG TCCTCCTCCGGCTCGGCCGCCGCGGCGCTGGACGCCGACTGCCGCCTGAAGCAGAACCTA CGCCTGACGGGCCCGGCGGCGGCTGAGCCGCGCTGCGCAGCCGACGCGGGAATGAAGCGG GCGCTGGGCAGGCGAAAGGGCGTGTGGTTGCGCCTGAGGAAGATACTTTTCTGTGTTTTG GGGTTGTACATTGCCATTCCATTTCTCATCAAACTATGTCCTGGAATACAGGCCAAACTG ATTTTCTTGAATTTCGTAAGAGTTCCCTATTTCATTGATTTGAAAAAACCACAGGATCAA GGTTTGAATCACACGTGTAACTACTACCTGCAGCCAGAGGAAGACGTGACCATTGGAGTC TGGCACACCGTCCCTGCAGTCTGGTGGAAGAACGCCCAAGGCAAAGACCAGATGTGGTAT GAGGATGCCTTGGCTTCCAGCCACCCTATCATTCTGTACCTGCATGGGAACGCAGGTACC AGAGGAGGCGACCACCGCGTGGAGCTTTACAAGGTGCTGAGTTCCCTTGGTTACCATGTG GTCACCTTTGACTACAGAGGTTGGGGTGACTCAGTGGGAACGCCATCTGAGCGGGGCATG ACCTATGACGCACTCCACGTTTTTGACTGGATCAAAGCAAGAAGTGGTGACAACCCCGTG TACATCTGGGGCCACTCTCTGGGCACTGGCGTGGCGACAAATCTGGTGCGGCGCCTCTGT GAGCGAGAGACGCCTCCAGATGCCCTTATATTGGAATCTCCATTCACTAATATCCGTGAA GAAGCTAAGAGCCATCCATTTTCAGTGATATATCGATACTTCCCTGGGTTTGACTGGTTC TTCCTTGATCCTATTACAAGTAGTGGAATTAAATTTGCAAATGATGAAAACGTGAAGCAC ATCTCCTGTCCCCTGCTCATCCTGCACGCTGAGGACGACCCGGTGGTGCCCTTCCAGCTT GGCAGAAAGCTCTATAGCATCGCCGCACCAGCTCGAAGCTTCCGAGATTTCAAAGTTCAG TTTGTGCCCTTTCATTCAGACCTTGGCTACAGGCACAAATACATTTACAAGAGCCCTGAG CTGCCACGGATACTGAGGGAATTCCTGGGGAAGTCGGAGCCTGAGCACCAGCACTGA |
| Restriction Sites | Please inquire |
| ACCN | NM_001042472 |
| Insert Size | 1200 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_001042472.1, NP_001035937.1 |
| RefSeq Size | 1983 bp |
| RefSeq ORF | 1197 bp |
| Locus ID | 26090 |
| UniProt ID | Q8N2K0 |
| Protein Families | Protease, Transmembrane |
| Gene Summary | This gene encodes an enzyme that catalyzes the hydrolysis of 2-arachidonoyl glycerol (2-AG), the main endocannabinoid lipid transmitter that acts on cannabinoid receptors, CB1 and CB2. The endocannabinoid system is involved in a wide range of physiological processes, including neurotransmission, mood, appetite, pain appreciation, addiction behavior, and inflammation. Mutations in this gene are associated with the neurodegenerative disease, PHARC (polyneuropathy, hearing loss, ataxia, retinitis pigmentosa, and cataract), resulting from an inborn error of endocannabinoid metabolism. Alternatively spliced transcript variants encoding different isoforms have been noted for this gene.[provided by RefSeq, Jan 2011] Transcript Variant: This variant (1) represents the predominant transcript and encodes the shorter isoform (a). |
Citations (1)
| The use of this cDNA Clones has been cited in the following citations: |
|---|
|
Robust Hydrolysis of Prostaglandin Glycerol Esters by Human Monoacylglycerol Lipase (MAGL)
,Savinainen, JR;Kansanen, E;Pantsar, T;Navia-Paldanius, D;Parkkari, T;Lehtonen, M;Laitinen, T;Nevalainen, T;Poso, A;Levonen, AL;Laitinen, JT;,
Mol. Pharmacol.
,PubMed ID 25140003
[ABHD12]
|
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC216963 | ABHD12 (Myc-DDK-tagged)-Human abhydrolase domain containing 12 (ABHD12), transcript variant 1 |
CNY 3,656.00 |
|
| RC216963L1 | Lenti ORF clone of Human abhydrolase domain containing 12 (ABHD12), transcript variant 1, Myc-DDK-tagged |
CNY 6,056.00 |
|
| RC216963L2 | Lenti ORF clone of Human abhydrolase domain containing 12 (ABHD12), transcript variant 1, mGFP tagged |
CNY 5,890.00 |
|
| RC216963L3 | Lenti ORF clone of Human abhydrolase domain containing 12 (ABHD12), transcript variant 1, Myc-DDK-tagged |
CNY 5,890.00 |
|
| RC216963L4 | Lenti ORF clone of Human abhydrolase domain containing 12 (ABHD12), transcript variant 1, mGFP tagged |
CNY 5,890.00 |
|
| RG216963 | ABHD12 (tGFP-tagged) - Human abhydrolase domain containing 12 (ABHD12), transcript variant 1 |
CNY 5,256.00 |
