PTPN20A (NM_001042395) Human Untagged Clone

CAT#: SC311257

PTPN20A (untagged)-Human protein tyrosine phosphatase, non-receptor type 20A (PTPN20A), transcript variant 8



  "NM_001042395" in other vectors (4)

CNY 5,510.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms bA142I17.1; CT126; hPTPN20; PTPN20B
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC311257 representing NM_001042395.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGTGGACAGCCAGAGGCCCCTTCAGAAGAGACAGGTGGAGCAGTGAGGATGAGGAGGCTGCAGGGCCA
TCACAGGCTCTCTCCCCTCTACTTTCTGATACGCGCAAAATTGTTTCTGAAGGAGAACTAGATCAGTTG
GCTCAGATTCGGCCATTAATATTCAATTTTCATGAGCAGACAGCCATCAAGGATTGTTTGAAAATCCTT
GAGGAAAAAACAGCAGCGTATGATATCATGCAGGAATTTATGGCTTTAGAACTTAAGAATCTGCCTGGT
GAGTTCAACTCTGGGAATCAACCAAGCAACAGAGAAAAAAACAGATACCGAGATATTCTTCCATATGAT
TCAACACGCGTTCCTCTTGGAAAAAGCAAGGACTACATCAATGCTAGTTATATTAGAATAGTCAATTGT
GGAGAAGAGTATTTTTATATCGCTACTCAAGGACCACTGCTGAGCACCATAGATGACTTTTGGCAAATG
GTGTTGGAAAATAATTCAAATGTTATTGCCATGATAACCAGAGAGATAGAAGGTGGAATTATCAAATGC
TACCATTACTGGCCCATTTCTCTGAAGAAGCCATTGGAATTGAAACACTTCCGTGTATTCCTGGAGAAC
TACCAGATACTTCAATATTTCATCATTCGAATGTTTCAAGTTGTGGAGAAGTCCACGGGAACTAGTCAC
TCTGTAAAACAGTTGCAGTTCACCAAGTGGCCAGACCATGGCACTCCTGCCTCAGCAGATAGCTTCATA
AAATATATTCGTTATGCAAGGAAGAGCCACCTTACAGGACCCATGGTTGTTCACTGCAGTGCCGGCATA
GGCCGGACAGGGGTGTTCCTATGTGTGGATGTCGTGTTCTGTGCCATCGTAAAGAACTGTTCATTCAAC
ATCATGGATATAGTGGCCCAAATGAGAGAACAACGTTCTGGCATGGTTCAAACGAAGGAGCAGTATCAC
TTTTGTTACGATATTGTGCTTGAAGTTCTTCGGAAACTTCTGACTTTGGATTAA

AGCGGACCGACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGAT
ATCCTGGATTACAAGGATGACGACGATAAG
GTTTAA
Restriction Sites SgfI-RsrII     
ACCN NM_001042395
Insert Size 1020 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001042395.1
RefSeq Size 2872 bp
RefSeq ORF 1020 bp
Locus ID 653129
Protein Families Druggable Genome
MW 39.2 kDa
Gene Summary The product of this gene belongs to the family of classical tyrosine-specific protein tyrosine phosphatases. Many protein tyrosine phosphatases have been shown to regulate fundamental cellular processes and several are mutated in human diseases. Chromosome 10q contains a segmental duplication resulting in multiple copies of the protein tyrosine phosphatase, non-receptor type 20 gene. The two nearly identical copies are designated as PTPN20A and PTPN20B. A third copy is only partially duplicated and contains a pseudogene, designated as PTPN20C. This gene encodes the more centromeric copy, PTPN20A. Multiple alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (8) differs in the 5' UTR and in the 5' coding region, compared to variant 1. The resulting protein (isoform 8) contains a distinct N-terminus, compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...