MST4 (STK26) (NM_001042453) Human Untagged Clone

CAT#: SC311255

MST4 (untagged)-Human serine/threonine protein kinase MST4 (MST4), transcript variant 2



  "NM_001042453" in other vectors (4)

CNY 5,510.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
STK26 Rabbit polyclonal Antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms MASK; MST4
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC311255 representing NM_001042453.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGCCCACTCGCCGGTGGCTGTCCAAGTGCCTGGGATGCAGGGGTCTAAATTATGGATAATAATGGAA
TACCTGGGCGGTGGTTCAGCACTGGATCTTCTTCGAGCTGGTCCATTTGATGAGTTCCAGATTGCTACC
ATGCTAAAGGAAATTTTAAAAGGTCTGGACTATCTGCATTCAGAAAAGAAAATTCACCGAGACATAAAA
GCTGCCAATGTCTTGCTCTCAGAACAAGGAGATGTTAAACTTGCTGATTTTGGAGTTGCTGGTCAGCTG
ACAGATACACAGATTAAAAGAAATACCTTTGTGGGAACTCCATTTTGGATGGCTCCTGAAGTTATTCAA
CAGTCAGCTTATGACTCAAAAGCTGACATTTGGTCATTGGGAATTACTGCTATTGAACTAGCCAAGGGA
GAGCCACCTAACTCCGATATGCATCCAATGAGAGTTCTGTTTCTTATTCCCAAAAACAATCCTCCAACT
CTTGTTGGAGACTTTACTAAGTCTTTTAAGGAGTTTATTGATGCTTGCCTGAACAAAGATCCATCATTT
CGTCCTACAGCAAAAGAACTTCTGAAACACAAATTCATTGTAAAAAATTCAAAGAAGACTTCTTATCTG
ACTGAACTGATAGATCGTTTTAAGAGATGGAAGGCAGAAGGACACAGTGATGATGAATCTGATTCCGAG
GGCTCTGATTCGGAATCTACCAGCAGGGAAAACAATACTCATCCTGAATGGAGCTTTACCACCGTACGA
AAGAAGCCTGATCCAAAGAAAGTACAGAATGGGGCAGAGCAAGATCTTGTGCAAACCCTGAGTTGTTTG
TCTATGATAATCACACCTGCATTTGCTGAACTTAAACAGCAGGACGAGAATAACGCTAGCAGGAATCAG
GCGATTGAAGAACTCGAGAAAAGTATTGCTGTGGCTGAAGCCGCCTGTCCCGGCATCACAGATAAAATG
GTGAAGAAACTAATTGAAAAATTTCAAAAGTGTTCAGCAGACGAATCCCCCTAA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001042453
Insert Size 1020 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001042453.1
RefSeq Size 3121 bp
RefSeq ORF 1020 bp
Locus ID 51765
UniProt ID Q9P289
Protein Families Druggable Genome, Protein Kinase
MW 37.8 kDa
Gene Summary The product of this gene is a member of the GCK group III family of kinases, which are a subset of the Ste20-like kinases. The encoded protein contains an amino-terminal kinase domain, and a carboxy-terminal regulatory domain that mediates homodimerization. The protein kinase localizes to the Golgi apparatus and is specifically activated by binding to the Golgi matrix protein GM130. It is also cleaved by caspase-3 in vitro, and may function in the apoptotic pathway. Several alternatively spliced transcript variants of this gene have been described, but the full-length nature of some of these variants has not been determined. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (2) lacks an alternate in-frame exon, compared to variant 1, resulting in a shorter isoform (2), compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...