United States
Germany
Japan
United Kingdom
China
Neuropeptide S (NPS) (NM_001030013) Human Untagged Clone
CAT＃: SC311206
NPS (untagged)-Human neuropeptide S (NPS), transcript variant 1
CNY 1,200.00
CNY 3,990.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Vector | pCMV6-XL5 |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | None |
| Sequence Data |
>OriGene sequence for NM_001030013 edited
GGAAGTCCAAAATGATTAGCTCAGTAAAACTCAATCTCATCCTAGTTCTGTCGCTGTCCA CAATGCATGTGTTTTGGTGTTATCCAGTTCCATCTTCTAAGGTGTCTGGAAAATCTGATT ACTTTCTCATTCTGCTGAACAGCTGCCCAACCAGATTGGACAGGAGCAAAGAACTAGCTT TTCTAAAGCCAATTTTGGAGAAGATGTTTGTGAAAAGGTCCTTTCGCAATGGAGTTGGCA CAGGGATGAAAAAAACTTCCTTTCAAAGAGCAAAATCATGA |
| Restriction Sites | Please inquire |
| ACCN | NM_001030013 |
| Insert Size | 300 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | The ORF of this clone has been fully sequenced and found to be a perfect match to NM_001030013.1. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_001030013.1, NP_001025184.1 |
| RefSeq Size | 322 bp |
| RefSeq ORF | 270 bp |
| Locus ID | 594857 |
| UniProt ID | P0C0P6 |
| Protein Families | Secreted Protein |
| Gene Summary | Modulates arousal and anxiety. May play an important anorexigenic role (By similarity). Binds to its receptor NPSR1 with nanomolar affinity to increase intracellular calcium concentrations (PubMed:15312648, PubMed:16790440).[UniProtKB/Swiss-Prot Function] |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC211361 | NPS (Myc-DDK-tagged)-Human neuropeptide S (NPS), transcript variant 1 |
CNY 1,200.00 |
|
| RC211361L3 | Lenti ORF clone of Human neuropeptide S (NPS), transcript variant 1, Myc-DDK-tagged |
CNY 5,890.00 |
|
| RC211361L4 | Lenti ORF clone of Human neuropeptide S (NPS), transcript variant 1, mGFP tagged |
CNY 5,890.00 |
|
| RG211361 | NPS (tGFP-tagged) - Human neuropeptide S (NPS), transcript variant 1 |
CNY 2,800.00 |
其它Neuropeptide S产品
