GAGE1 (NM_001040663) Human Untagged Clone
CAT#: SC311202
GAGE1 (untagged)-Human G antigen 1 (GAGE1), transcript variant 2
CNY 3,990.00
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | CT4.1; CT4.4; GAGE-1; GAGE-4; GAGE4 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC311202 representing NM_001040663.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGAGTTGGCGAGGAAGATCGACCTATTATTGGCCTAGACCAAGGCGCTATGTACAGCCTCCTGAAATG ATTGGGCCTATGCGGCCCGAGCAGTTCAGTGATGAAGTGGAACCAGCAACACCTGAAGAAGGGGAACCA GCAACTCAACGTCAGGATCCTGCAGCTGCTCAGGAGGGAGAGGATGAGGGAGCATCTGCAGGTCAAGGG CCGAAGCCTGAAGCTGATAGCCAGGAACAGGGTCACCCACAGACTGGGTGTGAGTGTGAAGATGGTCCT GATGGGCAGGAGATGGACCCGCCAAATCCAGAGGAGGTGAAAACGCCTGAAGAAGGTGAAGGGCAATCA CAGTGTTAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_001040663 |
Insert Size | 354 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001040663.2 |
RefSeq Size | 3014 bp |
RefSeq ORF | 354 bp |
Locus ID | 2543 |
UniProt ID | Q13065 |
MW | 12.9 kDa |
Gene Summary | This gene belongs to a family of genes that are expressed in a variety of tumors but not in normal tissues, except for the testis. The sequences of the family members are highly related but differ by scattered nucleotide substitutions. The antigenic peptide YRPRPRRY, which is also encoded by several other family members, is recognized by autologous cytolytic T lymphocytes. Nothing is presently known about the function of this protein. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2010] Transcript Variant: This variant (2) encodes the functional protein. CCDS Note: This CCDS representation is supported by the mRNA accession BC069470.1, which has its best hit to this GAGE family member. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC210119 | GAGE1 (Myc-DDK-tagged)-Human G antigen 1 (GAGE1), transcript variant 2 |
CNY 1,200.00 |
|
RC210119L3 | Lenti ORF clone of Human G antigen 1 (GAGE1), transcript variant 2, Myc-DDK-tagged |
CNY 5,890.00 |
|
RC210119L4 | Lenti ORF clone of Human G antigen 1 (GAGE1), transcript variant 2, mGFP tagged |
CNY 5,890.00 |
|
RG210119 | GAGE1 (tGFP-tagged) - Human G antigen 1 (GAGE1), transcript variant 2 |
CNY 2,800.00 |