NCALD (NM_001040626) Human Untagged Clone
CAT#: SC311191
NCALD (untagged)-Human neurocalcin delta (NCALD), transcript variant 3
CNY 3,990.00
Product images
CNY 1,999.00
CNY 2,700.00
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_001040626, the custom clone sequence may differ by one or more nucleotides
ATGGGGAAACAGAACAGCAAGCTGCGCCCGGAGGTCATGCAGGACTTGCTGGAAAGCACA GACTTTACAGAGCATGAGATCCAGGAATGGTATAAAGGCTTCTTGAGAGACTGCCCCAGT GGACATTTGTCAATGGAAGAGTTTAAGAAAATATATGGGAACTTTTTCCCTTATGGGGAT GCTTCCAAATTTGCAGAGCATGTCTTCCGCACCTTCGATGCAAATGGAGATGGGACAATA GACTTTAGAGAATTCATCATCGCCTTGAGTGTAACTTCGAGGGGGAAGCTGGAGCAGAAG CTGAAATGGGCCTTCAGCATGTACGACCTGGACGGAAATGGCTATATCAGCAAGGCAGAG ATGCTAGAGATCGTGCAGGCAATCTATAAGATGGTTTCCTCTGTAATGAAAATGCCTGAA GATGAGTCAACCCCAGAGAAAAGAACAGAAAAGATCTTCCGCCAGATGGACACCAATAGA GACGGAAAACTCTCCCTGGAAGAGTTCATCCGAGGAGCCAAAAGCGACCCGTCCATTGTG CGCCTCCTGCAGTGCGACCCGAGCAGTGCCGGCCAGTTCTGA |
Restriction Sites | Please inquire |
ACCN | NM_001040626 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001040626.1, NP_001035716.1 |
RefSeq Size | 3673 bp |
RefSeq ORF | 582 bp |
Locus ID | 83988 |
UniProt ID | P61601 |
Gene Summary | This gene encodes a member of the neuronal calcium sensor (NCS) family of calcium-binding proteins. The protein contains an N-terminal myristoylation signal and four EF-hand calcium binding loops. The protein is cytosolic at resting calcium levels; however, elevated intracellular calcium levels induce a conformational change that exposes the myristoyl group, resulting in protein association with membranes and partial co-localization with the perinuclear trans-golgi network. The protein is thought to be a regulator of G protein-coupled receptor signal transduction. Several alternatively spliced variants of this gene have been determined, all of which encode the same protein; additional variants may exist but their biological validity has not been determined. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (3) lacks an exon in the 5' UTR compared to variant 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC214160 | NCALD (Myc-DDK-tagged)-Human neurocalcin delta (NCALD), transcript variant 3 |
CNY 2,400.00 |
|
RC214160L3 | Lenti-ORF clone of NCALD (Myc-DDK-tagged)-Human neurocalcin delta (NCALD), transcript variant 3 |
CNY 5,890.00 |
|
RC214160L4 | Lenti-ORF clone of NCALD (mGFP-tagged)-Human neurocalcin delta (NCALD), transcript variant 3 |
CNY 5,890.00 |
|
RG214160 | NCALD (tGFP-tagged) - Human neurocalcin delta (NCALD), transcript variant 3 |
CNY 4,370.00 |