AMCase (CHIA) (NM_001040623) Human Untagged Clone
CAT#: SC311178
CHIA (untagged)-Human chitinase, acidic (CHIA), transcript variant 3
CNY 2,400.00
CNY 6,270.00
Product images
CNY 1,999.00
CNY 2,700.00
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | AMCASE; CHIT2; TSA1902 |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>OriGene sequence for NM_001040623 edited
GGAACAGCCAGCTGAAAACTCTCCTGGCCATTGGAGGCTGGAACTTCGGGACTGCCCCGA AATGCGTGAAGCTTTTGAGCAGGAGGCCAAGCAGATCAACAAGCCCAGGCTGATGGTCAC TGCTGCAGTAGCTGCTGGCATCTCCAATATCCAGTCTGGCTATGAGATCCCCCAACTGTC ACAGTACCTGGACTACATCCATGTCATGACCTACGACCTCCATGGCTCCTGGGAGGGCTA CACTGGAGAGAACAGCCCCCTCTACAAATACCCGACTGACACCGGCAGCAACGCCTACCT CAATGTGGATTATGTCATGAACTACTGGAAGGACAATGGAGCACCAGCTGAGAAGCTCAT CGTTGGATTCCCTACCTATGGACACAACTTCATCCTGAGCAACCCCTCCAACACTGGAAT TGGTGCCCCCACCTCTGGTGCTGGTCCTGCTGGGCCCTATGCCAAGGAGTCTGGGATCTG GGCTTACTACGAGATCTGTACCTTCCTGAAAAATGGAGCCACTCAGGGATGGGATGCCCC TCAGGAAGTGCCTTATGCCTATCAGGGCAATGTGTGGGTTGGCTATGACAACATCAAGAG CTTCGATATTAAGGCTCAATGGCTTAAGCACAACAAATTTGGAGGCGCCATGGTCTGGGC CATTGATCTGGATGACTTCACTGGCACTTTCTGCAACCAGGGCAAGTTTCCCCTAATCTC CACCCTGAAGAAGGCCCTCGGCCTGCAGAGTGCAAGTTGCACGGCTCCAGCTCAGCCCAT TGAGCCAATAACTGCTGCTCCCAGTGGCAGCGGGAACGGGAGCGGGAGTAGCAGCTCTGG AGGCAGCTCGGGAGGCAGTGGATTCTGTGCTGTCAGAGCCAACGGCCTCTACCCCGTGGC AAATAACAGAAATGCCTTCTGGCACTGCGTGAATGGAGTCACGTACCAGCAGAACTGCCA GGCCGGGCTTGTCTTCGACACCAGCTGTGATTGCTGCAACTGGGCATAAACCTGACCTGG TCTATATTCCCTAGAGTTCCAGTCTCTTTTGCTTAGGACATGTTGCCCCTACCTAAAGTC CTGCAATA |
Restriction Sites | Please inquire |
ACCN | NM_001040623 |
Insert Size | 1100 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | The open reading frame of this TrueClone was fully sequenced and found to be a perfect match to the protein associated to this reference. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001040623.1, NP_001035713.1 |
RefSeq Size | 1229 bp |
RefSeq ORF | 948 bp |
Locus ID | 27159 |
UniProt ID | Q9BZP6 |
Protein Families | Secreted Protein |
Protein Pathways | Amino sugar and nucleotide sugar metabolism |
Gene Summary | The protein encoded by this gene degrades chitin, which is found in the cell wall of most fungi as well as in arthropods and some nematodes. The encoded protein can also stimulate interleukin 13 expression, and variations in this gene can lead to asthma susceptibility. Several transcript variants encoding a few different isoforms have been found for this gene. [provided by RefSeq, Apr 2012] Transcript Variant: This variant (3) lacks exons in the 5' end of the coding region compared to variant 4. The resulting isoform (b, also known as TSA1902-S) is shorter at the N-terminus compared to isoform a. Variants 3, 6, 8, and 9 all encode the same isoform (b). |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC233733 | CHIA (Myc-DDK tagged) - Homo sapiens chitinase, acidic (CHIA), transcript variant 3 |
CNY 3,990.00 |
|
RG233733 | CHIA (tGFP-tagged) - Homo sapiens chitinase, acidic (CHIA), transcript variant 3 |
CNY 4,370.00 |
|
SC331124 | CHIA (untagged) - Homo sapiens chitinase, acidic (CHIA), transcript variant 3 |
CNY 3,040.00 |