RHBDD2 (NM_001040456) Human Untagged Clone

CAT#: SC311174

RHBDD2 (untagged)-Human rhomboid domain containing 2 (RHBDD2), transcript variant 1



  "NM_001040456" in other vectors (4)

CNY 3,656.00

CNY 7,220.00


货期*
现货

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit Polyclonal RHBDD2 Antibody
    • 100 ug

CNY 5,808.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms NPD007; RHBDL7
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>OriGene sequence for NM_001040456 edited
ATGGCGGCCTCGGGGCCCGGGTGTCGCAGCTGGTGCTTGTGTCCCGAGGTGCCATCCGCC
ACCTTCTTCACTGCGCTGCTCTCGCTGCTGGTTTCCGGGCCTCGCCTGTTCCTGCTGCAG
CAGCCCCTGGCGCCCTCGGGCCTCACGCTGAAGTCCGAGGCCCTTCGCAACTGGCAAGTT
TACAGGCTGGTAACCTACATCTTTGTCTACGAGAATCCCATCTCCCTGCCCTGCGGCGCT
ATCATCATCTGGCGCTTTGCTGGCAATTTCGAGAGAACCGTGGGCACCGTCCGCCACTGC
TTCTTCACCGTGATCTTCGCCATCTTCTCCGCTATCATCTTCCTGTCATTCGAGGCTGTG
TCATCACTGTCAAAGCTGGGGGAAGTGGAGGATGCCAGAGGTTTCACCCCAGTGGCCTTT
GCCATGCTGGGAGTCACCACCGTCCGTTCTCGGATGAGGCGGGCCCTGGTGTTTGGCATG
GTTGTGCCCTCAGTCCTGGTTCCGTGGCTCCTGCTGGGTGCCTCGTGGCTCATTCCCCAG
ACCTCTTTCCTCAGTAATGTCTGCGGGCTGTCCATCGGGCTGGCCTATGGCCTCACCTAC
TGCTATTCCATCGACCTCTCAGAGCGAGTGGCGCTGAAGCTCGATCAGACCTTCCCCTTC
AGCCTGATGAGGAGGATATCCGTGTTCAAGTACGTCTCAGGGTCTTCAGCCGAGAGGAGG
GCAGCCCAGAGCCGGAAACTGAACCCGGTGCCTGGCTCCTACCCCACACAGAGCTGCCAC
CCTCACCTGTCCCCAAGCCACCCTGTGTCCCAGACGCAGCACGCCAGTGGTCAGAAGCTG
GCCTCCTGGCCCTCCTGCACCCCCGGGCACATGCCCACCTTGCCTCCGTACCAGCCTGCC
TCCGGCCTGTGCTATGTGCAGAACCACTTTGGTCCAAACCCCACCTCCTCCAGTGTCTAC
CCAGCTTCTGCGGGCACCTCCCTGGGCATCCAGCCCCCCACGCCTGTGAACAGCCCTGGC
ACGGTGTATTCTGGGGCCTTGGGCACACCAGGGGCTGCAGGCTCCAAGGAGTCCTCCAGG
GTCCCCATGCCCTGA
Restriction Sites Please inquire     
ACCN NM_001040456
Insert Size 1100 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001040456.1, NP_001035546.1
RefSeq Size 1756 bp
RefSeq ORF 1095 bp
Locus ID 57414
UniProt ID Q6NTF9
Protein Families Transmembrane
Gene Summary The protein encoded by this gene is a member of the rhomboid family of membrane-bound proteases and is overexpressed in some breast cancers. Members of this family are involved in intramembrane proteolysis. In mouse, the orthologous protein associates with the Golgi body. [provided by RefSeq, Sep 2016]
Transcript Variant: This variant (1) encodes the longest isoform (a). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...