CD79B (NM_001039933) Human Untagged Clone
CAT#: SC311082
CD79B (untagged)-Human CD79b molecule, immunoglobulin-associated beta (CD79B), transcript variant 3
CNY 3,990.00
Product images
CNY 1,999.00
CNY 2,700.00
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | AGM6; B29; IGB |
Vector | pCMV6-AC |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>OriGene sequence for NM_001039933 edited
CAGAGCGGTGACCATGGCCAGGCTGGCGTTGTCTCCTGTGCCCAGCCACTGGATGGTGGC GTTGCTGCTGCTGCTCTCAGCAGCTGAGCCAGTACCAGCAGCCAGATCGGAGGACCGGTA CCGGAATCCCAAAGGTAGTGCTTGTTCGCGGATCTGGCAGAGCCCACGTTTCATAGCCAG GAAACGGGGCTTCACGGTGAAAATGCACTGCTACATGAACAGCGCCTCCGGCAATGTGAG CTGGCTCTGGAAGCAGGAGATGGACGAGAATCCCCAGCAGCTGAAGCTGGAAAAGGGCCG CATGGAAGAGTCCCAGAACGAATCTCTCGCCACCCTCACCATCCAAGGCATCCGGTTTGA GGACAATGGCATCTACTTCTGCCAGCAGAAGTGCAACAACACCTCGGAGGTCTACCAGGG CTGCGGCACAGAGCTGCGAGTCATGGGATTCAGCACCTTGGCACAGCTGAAGCAGAGGAA CACGCTGAAGGATGGTATCATCATGATCCAGACGCTGCTGATCATCCTCTTCATCATCGT GCCTATCTTCCTGCTGCTGGACAAGGATGACAGCAAGGCTGGCATGGAGGAAGATCACAC CTACGAGGGCCTGGACATTGACCAGACAGCCACCTATGAGGACATAGTGACGCTGCGGAC AGGGGAAGTGAAGTGGTCTGTAGGTGAGCACCCAGGCCAGGAGTGAGAGCCAGGTCGCCC CATGACCTGGGTGCAGGCTCCCTGGCCTCAGTGACTGCTTCGGAGCTGCCTGGCTCATGG CCCAACCCCTTTCCCGGACCCCCCAGCTGGCCTCTGAAGCTGGCCCACCAGAGCTGCCAT TTGTCTCCAGCCCCTGGTCCCCAGCTCTTGCCAAAGGGCCTGGAGTAGAAGGACAACAGG GCAGCAACTTGGAGGGAGTTCTCTGGGGATGGACGGGACCCAGCCTTCTGGGGGTGCTAT GAGGTGATCCGTCCCCACACATGGGATGGGGGAGGCAGAGACTGGTCCAGAGCCCGCAAA TGGACTCGGAGCCGAGGGCCTCCCAGCAGAGCTTGGGAAGGGCCATGGACCCAACTGGGC CCCAGAAGAGCCACAGGAACATCATTCCTCTCCCGCAACCACTCCCACCCCAGGGAGGCC CTGGCCTCCAGTGCCTTCCCCCGTGGAATAAACGGTGTGTCCTGAGAAACCAAAAAAAAA AAAAAA |
Restriction Sites | Please inquire |
ACCN | NM_001039933 |
Insert Size | 1200 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | The ORF of this clone has been fully sequenced and found to be a perfect match to NM_001039933.1. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001039933.1, NP_001035022.1 |
RefSeq Size | 1303 bp |
RefSeq ORF | 693 bp |
Locus ID | 974 |
UniProt ID | P40259 |
Protein Families | Druggable Genome, Transmembrane |
Protein Pathways | B cell receptor signaling pathway |
Gene Summary | The B lymphocyte antigen receptor is a multimeric complex that includes the antigen-specific component, surface immunoglobulin (Ig). Surface Ig non-covalently associates with two other proteins, Ig-alpha and Ig-beta, which are necessary for expression and function of the B-cell antigen receptor. This gene encodes the Ig-beta protein of the B-cell antigen component. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (3) represents the longest transcript and encodes the longest isoform (3). |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC200665 | CD79B (Myc-DDK-tagged)-Human CD79b molecule, immunoglobulin-associated beta (CD79B), transcript variant 3 |
CNY 3,656.00 |
|
RC200665L1 | Lenti ORF clone of Human CD79b molecule, immunoglobulin-associated beta (CD79B), transcript variant 3, Myc-DDK-tagged |
CNY 6,056.00 |
|
RC200665L2 | Lenti ORF clone of Human CD79b molecule, immunoglobulin-associated beta (CD79B), transcript variant 3, mGFP tagged |
CNY 5,890.00 |
|
RC200665L3 | Lenti ORF clone of Human CD79b molecule, immunoglobulin-associated beta (CD79B), transcript variant 3, Myc-DDK-tagged |
CNY 6,056.00 |
|
RC200665L4 | Lenti ORF clone of Human CD79b molecule, immunoglobulin-associated beta (CD79B), transcript variant 3, mGFP tagged |
CNY 5,890.00 |
|
RG200665 | CD79B (tGFP-tagged) - Human CD79b molecule, immunoglobulin-associated beta (CD79B), transcript variant 3 |
CNY 5,256.00 |
|
SC321002 | CD79B (untagged)-Human CD79b molecule, immunoglobulin-associated beta (CD79B), transcript variant 3 |
CNY 2,400.00 |