SIRP alpha (SIRPA) (NM_001040022) Human Untagged Clone
CAT#: SC311067
SIRPA (untagged)-Human signal-regulatory protein alpha (SIRPA), transcript variant 1
CNY 5,640.00
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
CNY 1,999.00
CNY 2,700.00
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | BIT; CD172A; MFR; MYD-1; P84; PTPNS1; SHPS1; SIRP |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>OriGene ORF sequence for NM_001040022 edited
ATGGAGCCCGCCGGCCCGGCCCCCGGCCGCCTCGGGCCGCTGCTCTGCCTGCTGCTCGCC GCGTCCTGCGCCTGGTCAGGAGTGGCGGGTGAGGAGGAGCTGCAGGTGATTCAGCCTGAC AAGTCCGTGTTGGTTGCAGCTGGAGAGACAGCCACTCTGCGCTGCACTGCGACCTCTCTG ATCCCTGTGGGGCCCATCCAGTGGTTCAGAGGAGCTGGACCAGGCCGGGAATTAATCTAC AATCAAAAAGAAGGCCACTTCCCCCGGGTAACAACTGTTTCAGACCTCACAAAGAGAAAC AACATGGACTTTTCCATCCGCATCGGTAACATCACCCCAGCAGATGCCGGCACCTACTAC TGTGTGAAGTTCCGGAAAGGGAGCCCCGATGACGTGGAGTTTAAGTCTGGAGCAGGCACT GAGCTGTCTGTGCGCGCCAAACCCTCTGCCCCCGTGGTATCGGGCCCTGCGGCGAGGGCC ACACCTCAGCACACAGTGAGCTTCACCTGCGAGTCCCACGGCTTCTCACCCAGAGACATC ACCCTGAAATGGTTCAAAAATGGGAATGAGCTCTCAGACTTCCAGACCAACGTGGACCCC GTAGGAGAGAGCGTGTCCTACAGCATCCACAGCACAGCCAAGGTGGTGCTGACCCGCGAG GACGTTCACTCTCAAGTCATCTGCGAGGTGGCCCACGTCACCTTGCAGGGGGACCCTCTT CGTGGGACTGCCAACTTGTCTGAGACCATCCGAGTTCCACCCACCTTGGAGGTTACTCAA CAGCCCGTGAGGGCAGAGAACCAGGTGAATGTCACCTGCCAGGTGAGGAAGTTCTACCCC CAGAGACTACAGCTGACCTGGTTGGAGAATGGAAACGTGTCCCGGACAGAAACGGCCTCA ACCGTTACAGAGAACAAGGATGGTACCTACAACTGGATGAGCTGGCTCCTGGTGAATGTA TCTGCCCACAGGGATGATGTGAAGCTCACCTGCCAGGTGGAGCATGACGGGCAGCCAGCG GTCAGCAAAAGCCATGACCTGAAGGTCTCAGCCCACCCGAAGGAGCAGGGCTCAAATACC GCCGCTGAGAACACTGGATCTAATGAACGGAACATCTATATTGTGGTGGGTGTGGTGTGC ACCTTGCTGGTGGCCCTACTGATGGCGGCCCTCTACCTCGTCCGAATCAGACAGAAGAAA GCCCAGGGCTCCACTTCTTCTACAAGGTTGCATGAGCCCGAGAAGAATGCCAGAGAAATA ACACAGGACACAAATGATATCACATATGCAGACCTGAACCTGCCCAAGGGGAAGAAGCCT GCTCCCCAGGCTGCGGAGCCCAACAACCACACGGAGTATGCCAGCATTCAGACCAGCCCG CAGCCCGCGTCGGAGGACACCCTCACCTATGCTGACCTGGACATGGTCCACCTCAACCGG ACCCCCAAGCAGCCGGCCCCCAAGCCTGAGCCGTCCTTCTCAGAGTACGCCAGCGTCCAG GTCCCGAGGAAGTGA |
Restriction Sites | Please inquire |
ACCN | NM_001040022 |
Insert Size | 2500 bp |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001040022.1, NP_001035111.1 |
RefSeq Size | 4201 bp |
RefSeq ORF | 1515 bp |
Locus ID | 140885 |
UniProt ID | P78324 |
Protein Families | Druggable Genome, Phosphatase, Transmembrane |
Gene Summary | The protein encoded by this gene is a member of the signal-regulatory-protein (SIRP) family, and also belongs to the immunoglobulin superfamily. SIRP family members are receptor-type transmembrane glycoproteins known to be involved in the negative regulation of receptor tyrosine kinase-coupled signaling processes. This protein can be phosphorylated by tyrosine kinases. The phospho-tyrosine residues of this PTP have been shown to recruit SH2 domain containing tyrosine phosphatases (PTP), and serve as substrates of PTPs. This protein was found to participate in signal transduction mediated by various growth factor receptors. CD47 has been demonstrated to be a ligand for this receptor protein. This gene and its product share very high similarity with several other members of the SIRP family. These related genes are located in close proximity to each other on chromosome 20p13. Multiple alternatively spliced transcript variants have been determined for this gene. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (1) uses an alternate, in-frame, splice donor site in the 3' coding region compared to variant 4. This variant encodes a shorter protein (isoform 1) compared to isoform 2. Variants 1, 2, and 3 encode the same protein (isoform 1). |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC222380 | SIRPA (Myc-DDK-tagged)-Human signal-regulatory protein alpha (SIRPA), transcript variant 1 |
CNY 3,760.00 |
|
RC222380L1 | Lenti ORF clone of Human signal-regulatory protein alpha (SIRPA), transcript variant 1, Myc-DDK-tagged |
CNY 6,160.00 |
|
RC222380L2 | Lenti ORF clone of Human signal-regulatory protein alpha (SIRPA), transcript variant 1, mGFP tagged |
CNY 6,160.00 |
|
RC222380L3 | Lenti ORF clone of Human signal-regulatory protein alpha (SIRPA), transcript variant 1, Myc-DDK-tagged |
CNY 6,160.00 |
|
RC222380L4 | Lenti ORF clone of Human signal-regulatory protein alpha (SIRPA), transcript variant 1, mGFP tagged |
CNY 6,160.00 |
|
RG222380 | SIRPA (tGFP-tagged) - Human signal-regulatory protein alpha (SIRPA), transcript variant 1 |
CNY 5,360.00 |
其它SIRP alpha产品