ATP6V1E1 (NM_001039366) Human Untagged Clone

CAT#: SC310899

ATP6V1E1 (untagged)-Human ATPase, H+ transporting, lysosomal 31kDa, V1 subunit E1 (ATP6V1E1), transcript variant 2



  "NM_001039366" in other vectors (4)

CNY 3,990.00


货期*
5周

规格
    • 10 ug

Product images

经常一起买 (4)
ATP6V1E1 Rabbit polyclonal Antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms ARCL2C; ATP6E; ATP6E2; ATP6V1E; P31; Vma4
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001039366, the custom clone sequence may differ by one or more nucleotides
ATGGCTCTCAGCGATGCTGACGTGCAAAAGCAGGCAGAAGAAGAGTTCAACATAGAGAAA
GGTCGGCTTGTGCAAACCCAAAGACTAAAGATTATGGAATATTATGAGAAGAAAGAGAAA
CAGATTGAGCAGCAGAAGAAAATTCAGATGTCCAATTTGATGAATCAAGCGAGACTCAAA
GTCCTCAGAGCAAGAGATGACCTTATCACAGACCTACTAAATGAAGCAAAACAGAGACTC
AGCAAGGTGGTAAAAGATACAACCAGGTACCAAGTGCTGCTGGATGGACTGGTTCTCCAG
GGTTTGTACCAGTTGCTGGAGCCCCGAATGATTGTTCGTTGCAGGAAACAAGATTTCCCT
CTGGTAAAGGCTGCAGTGCAGAAGGCAATTCCTATGTACAAAATTGCCACCAAAAACGAT
GTTGATGTCCAAATTGACCAGGAGTCCTACCTGCCTGAAGACATAGCTGGTGGAGTTGAG
ATCTATAATGGAGATCGTAAAATAAAGGTTTCCAACACCCTGGAAAGCCGGCTGGATCTC
ATAGCCCAGCAGATGATGCCAGAAGTCCGGGGAGCCTTGTTTGGTGCAAATGCCAACAGG
AAGTTTTTGGACTAA
Restriction Sites Please inquire     
ACCN NM_001039366
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001039366.1, NP_001034455.1
RefSeq Size 1340 bp
RefSeq ORF 615 bp
Locus ID 529
UniProt ID P36543
Protein Pathways Epithelial cell signaling in Helicobacter pylori infection, Metabolic pathways, Oxidative phosphorylation, Vibrio cholerae infection
Gene Summary This gene encodes a component of vacuolar ATPase (V-ATPase), a multisubunit enzyme that mediates acidification of eukaryotic intracellular organelles. V-ATPase dependent organelle acidification is necessary for such intracellular processes as protein sorting, zymogen activation, receptor-mediated endocytosis, and synaptic vesicle proton gradient generation. V-ATPase is composed of a cytosolic V1 domain and a transmembrane V0 domain. The V1 domain consists of three A, three B, and two G subunits, as well as a C, D, E, F, and H subunit. The V1 domain contains the ATP catalytic site. This gene encodes alternate transcriptional splice variants, encoding different V1 domain E subunit isoforms. Pseudogenes for this gene have been found in the genome. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (2) lacks an alternate in-frame exon, compared to variant 1, resulting in a shorter protein (isoform b), compared to isoform a.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...