United States
Germany
Japan
United Kingdom
China
EFEMP1 (NM_001039348) Human Untagged Clone
CAT＃: SC310892
EFEMP1 (untagged)-Human EGF containing fibulin-like extracellular matrix protein 1 (EFEMP1), transcript variant 2
CNY 5,488.00
Product images
CNY 1,999.00
CNY 2,700.00
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | DHRD; DRAD; FBLN3; FBNL; FIBL-3; MLVT; MTLV; S1-5 |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>NCBI ORF sequence for NM_001039348, the custom clone sequence may differ by one or more nucleotides
ATGTTGAAAGCCCTTTTCCTAACTATGCTGACTCTGGCGCTGGTCAAGTCACAGGACACCGAAGAAACCA TCACGTACACGCAATGCACTGACGGATATGAGTGGGATCCTGTGAGACAGCAATGCAAAGATATTGATGA ATGTGACATTGTCCCAGACGCTTGTAAAGGTGGAATGAAGTGTGTCAACCACTATGGAGGATACCTCTGC CTTCCGAAAACAGCCCAGATTATTGTCAATAATGAACAGCCTCAGCAGGAAACACAACCAGCAGAAGGAA CCTCAGGGGCAACCACCGGGGTTGTAGCTGCCAGCAGCATGGCAACCAGTGGAGTGTTGCCCGGGGGTGG TTTTGTGGCCAGTGCTGCTGCAGTCGCAGGCCCTGAAATGCAGACTGGCCGAAATAACTTTGTCATCCGG CGGAACCCAGCTGACCCTCAGCGCATTCCCTCCAACCCTTCCCACCGTATCCAGTGTGCAGCAGGCTACG AGCAAAGTGAACACAACGTGTGCCAAGACATAGACGAGTGCACTGCAGGGACGCACAACTGTAGAGCAGA CCAAGTGTGCATCAATTTACGGGGATCCTTTGCATGTCAGTGCCCTCCTGGATATCAGAAGCGAGGGGAG CAGTGCGTAGACATAGATGAATGTACCATCCCTCCATATTGCCACCAAAGATGCGTGAATACACCAGGCT CATTTTATTGCCAGTGCAGTCCTGGGTTTCAATTGGCAGCAAACAACTATACCTGCGTAGATATAAATGA ATGTGATGCCAGCAATCAATGTGCTCAGCAGTGCTACAACATTCTTGGTTCATTCATCTGTCAGTGCAAT CAAGGATATGAGCTAAGCAGTGACAGGCTCAACTGTGAAGACATTGATGAATGCAGAACCTCAAGCTACC TGTGTCAATATCAATGTGTCAATGAACCTGGGAAATTCTCATGTATGTGCCCCCAGGGATACCAAGTGGT GAGAAGTAGAACATGTCAAGATATAAATGAGTGTGAGACCACAAATGAATGCCGGGAGGATGAAATGTGT TGGAATTATCATGGCGGCTTCCGTTGTTATCCACGAAATCCTTGTCAAGATCCCTACATTCTAACACCAG AGAACCGATGTGTTTGCCCAGTCTCAAATGCCATGTGCCGAGAACTGCCCCAGTCAATAGTCTACAAATA CATGAGCATCCGATCTGATAGGTCTGTGCCATCAGACATCTTCCAGATACAGGCCACAACTATTTATGCC AACACCATCAATACTTTTCGGATTAAATCTGGAAATGAAAATGGAGAGTTCTACCTACGACAAACAAGTC CTGTAAGTGCAATGCTTGTGCTCGTGAAGTCATTATCAGGACCAAGAGAACATATCGTGGACCTGGAGAT GCTGACAGTCAGCAGTATAGGGACCTTCCGCACAAGCTCTGTGTTAAGATTGACAATAATAGTGGGGCCA TTTTCATTTTAG |
| Restriction Sites | Please inquire |
| ACCN | NM_001039348 |
| OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Reference Data | |
| RefSeq | NM_001039348.1, NP_001034437.1 |
| RefSeq Size | 2741 bp |
| RefSeq ORF | 1482 bp |
| Locus ID | 2202 |
| UniProt ID | Q12805 |
| Protein Families | Secreted Protein |
| Gene Summary | This gene encodes a member of the fibulin family of extracellular matrix glycoproteins. Like all members of this family, the encoded protein contains tandemly repeated epidermal growth factor-like repeats followed by a C-terminus fibulin-type domain. This gene is upregulated in malignant gliomas and may play a role in the aggressive nature of these tumors. Mutations in this gene are associated with Doyne honeycomb retinal dystrophy. Alternatively spliced transcript variants that encode the same protein have been described.[provided by RefSeq, Nov 2009] Transcript Variant: This variant (2) represents the longer transcript. Variants 2 and 3 encode the same protein. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC216753 | EFEMP1 (Myc-DDK-tagged)-Human EGF containing fibulin-like extracellular matrix protein 1 (EFEMP1), transcript variant 2 |
CNY 5,488.00 |
|
| RC216753L1 | Lenti ORF clone of Human EGF containing fibulin-like extracellular matrix protein 1 (EFEMP1), transcript variant 2, Myc-DDK-tagged |
CNY 7,888.00 |
|
| RC216753L2 | Lenti ORF clone of Human EGF containing fibulin-like extracellular matrix protein 1 (EFEMP1), transcript variant 2, mGFP tagged |
CNY 5,890.00 |
|
| RC216753L3 | Lenti ORF clone of Human EGF containing fibulin-like extracellular matrix protein 1 (EFEMP1), transcript variant 2, Myc-DDK-tagged |
CNY 7,888.00 |
|
| RC216753L4 | Lenti ORF clone of Human EGF containing fibulin-like extracellular matrix protein 1 (EFEMP1), transcript variant 2, mGFP tagged |
CNY 7,888.00 |
|
| RG216753 | EFEMP1 (tGFP-tagged) - Human EGF containing fibulin-like extracellular matrix protein 1 (EFEMP1), transcript variant 2 |
CNY 4,370.00 |
