FHL2 (NM_001039492) Human Untagged Clone
CAT#: SC310878
FHL2 (untagged)-Human four and a half LIM domains 2 (FHL2), transcript variant 5
CNY 6,270.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | AAG11; DRAL; FHL-2; SLIM-3; SLIM3 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC310878 representing NM_001039492.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGACTGAGCGCTTTGACTGCCACCATTGCAACGAATCTCTCTTTGGCAAGAAGTACATCCTGCGGGAG GAGAGCCCCTACTGCGTGGTGTGCTTTGAGACCCTGTTCGCCAACACCTGCGAGGAGTGTGGGAAGCCC ATCGGCTGTGACTGCAAGGACTTGTCTTACAAGGACCGGCACTGGCATGAAGCCTGTTTCCACTGCTCG CAGTGCAGAAACTCACTGGTGGACAAGCCCTTTGCTGCCAAGGAGGACCAGCTGCTCTGTACAGACTGC TATTCCAACGAGTACTCATCCAAGTGCCAGGAATGCAAGAAGACCATCATGCCAGGTACCCGCAAGATG GAGTACAAGGGCAGCAGCTGGCATGAGACCTGCTTCATCTGCCACCGCTGCCAGCAGCCAATTGGAACC AAGAGTTTCATCCCCAAAGACAATCAGAATTTCTGTGTGCCCTGCTATGAGAAACAACATGCCATGCAG TGCGTTCAGTGCAAAAAGCCCATCACCACGGGAGGGGTCACTTACCGGGAGCAGCCCTGGCACAAGGAG TGCTTCGTGTGCACCGCCTGCAGGAAGCAGCTGTCTGGGCAGCGCTTCACAGCTCGCGATGACTTTGCC TACTGCCTGAACTGCTTCTGTGACTTGTATGCCAAGAAGTGTGCTGGGTGCACCAACCCCATCAGCGGA CTTGGTGGCACAAAATACATCTCCTTTGAGGAACGGCAGTGGCATAACGACTGCTTTAACTGTAAGAAG TGCTCCCTCTCACTGGTGGGGCGTGGCTTCCTCACAGAGAGGGACGACATCCTGTGCCCCGACTGTGGG AAAGACATCTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_001039492 |
Insert Size | 840 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001039492.2 |
RefSeq Size | 1552 bp |
RefSeq ORF | 840 bp |
Locus ID | 2274 |
UniProt ID | Q14192 |
Protein Families | Druggable Genome |
MW | 32.2 kDa |
Gene Summary | This gene encodes a member of the four-and-a-half-LIM-only protein family. Family members contain two highly conserved, tandemly arranged, zinc finger domains with four highly conserved cysteines binding a zinc atom in each zinc finger. This protein is thought to have a role in the assembly of extracellular membranes. Also, this gene is down-regulated during transformation of normal myoblasts to rhabdomyosarcoma cells and the encoded protein may function as a link between presenilin-2 and an intracellular signaling pathway. Multiple alternatively spliced variants encoding different isoforms have been identified. [provided by RefSeq, Jan 2016] Transcript Variant: This variant (5) differs in the 5' UTR compared to variant 2. Variants 1, 2, 4, 5, 6, 7, and 8 all encode the same isoform (a). |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC219762 | FHL2 (Myc-DDK-tagged)-Human four and a half LIM domains 2 (FHL2), transcript variant 5 |
CNY 2,400.00 |
|
RC219762L3 | Lenti ORF clone of Human four and a half LIM domains 2 (FHL2), transcript variant 5, Myc-DDK-tagged |
CNY 5,890.00 |
|
RC219762L4 | Lenti ORF clone of Human four and a half LIM domains 2 (FHL2), transcript variant 5, mGFP tagged |
CNY 5,890.00 |
|
RG219762 | FHL2 (tGFP-tagged) - Human four and a half LIM domains 2 (FHL2), transcript variant 5 |
CNY 4,370.00 |