CD151 (NM_001039490) Human Untagged Clone

CAT#: SC310865

CD151 (untagged)-Human CD151 molecule (Raph blood group) (CD151), transcript variant 5



  "NM_001039490" in other vectors (4)

CNY 3,990.00


货期*
5周

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


Anti-CD151 Rabbit Polyclonal Antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms GP27; MER2; PETA-3; RAPH; SFA1; TSPAN24
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001039490, the custom clone sequence may differ by one or more nucleotides
ATGGGTGAGTTCAACGAGAAGAAGACAACATGTGGCACCGTTTGCCTCAAGTACCTGCTG
TTTACCTACAATTGCTGCTTCTGGCTGGCTGGCCTGGCTGTCATGGCAGTGGGCATCTGG
ACGCTGGCCCTCAAGAGTGACTACATCAGCCTGCTGGCCTCAGGCACCTACCTGGCCACA
GCCTACATCCTGGTGGTGGCGGGCACTGTCGTCATGGTGACTGGGGTCTTGGGCTGCTGC
GCCACCTTCAAGGAGCGTCGGAACCTGCTGCGCCTGTACTTCATCCTGCTCCTCATCATC
TTTCTGCTGGAGATCATCGCTGGTATCCTCGCCTACGCCTACTACCAGCAGCTGAACACG
GAGCTCAAGGAGAACCTGAAGGACACCATGACCAAGCGCTACCACCAGCCGGGCCATGAG
GCTGTGACCAGCGCTGTGGACCAGCTGCAGCAGGAGTTCCACTGCTGTGGCAGCAACAAC
TCACAGGACTGGCGAGACAGTGAGTGGATCCGCTCACAGGAGGCCGGTGGCCGTGTGGTC
CCAGACAGCTGCTGCAAGACGGTGGTGGCTCTTTGTGGGCAGCGAGACCATGCCTCCAAC
ATCTACAAGGTGGAGGGCGGCTGCATCACCAAGTTGGAGACCTTCATCCAGGAGCACCTG
AGGGTCATTGGGGCTGTGGGGATCGGCATTGCCTGTGTGCAGGTCTTTGGCATGATCTTC
ACGTGCTGCCTGTACAGGAGTCTCAAGCTGGAGCACTACTGA
Restriction Sites Please inquire     
ACCN NM_001039490
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001039490.1, NP_001034579.1
RefSeq Size 1508 bp
RefSeq ORF 762 bp
Locus ID 977
UniProt ID P48509
Protein Families Druggable Genome, Transmembrane
Gene Summary The protein encoded by this gene is a member of the transmembrane 4 superfamily, also known as the tetraspanin family. Most of these members are cell-surface proteins that are characterized by the presence of four hydrophobic domains. The proteins mediate signal transduction events that play a role in the regulation of cell development, activation, growth and motility. This encoded protein is a cell surface glycoprotein that is known to complex with integrins and other transmembrane 4 superfamily proteins. It is involved in cellular processes including cell adhesion and may regulate integrin trafficking and/or function. This protein enhances cell motility, invasion and metastasis of cancer cells. Multiple alternatively spliced transcript variants that encode the same protein have been described for this gene. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (5) lacks an alternate segment of sequence in the 5' UTR, compared to variant 1. All variants encode the same protein.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...