DEDD (NM_001039712) Human Untagged Clone

CAT#: SC310813

DEDD (untagged)-Human death effector domain containing (DEDD), transcript variant 4



  "NM_001039712" in other vectors (4)

CNY 6,270.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit polyclonal antibody to DEDD (death effector domain containing)
    • 100 ul

CNY 6,281.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms CASP8IP1; DEDD1; DEFT; FLDED1; KE05
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC310813 representing NM_001039712.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGCGGGCCTAAAGCGGCGGGCAAGCCAGGTGTGGCCAGAAGAGCATGGTGAGCAGGAACATGGGCTG
TACAGCCTGCACCGCATGTTTGACATCGTGGGCACTCATCTGACACACAGAGATGTGCGCGTGCTTTCT
TTCCTCTTTGTTGATGTCATTGATGACCACGAGCGTGGACTCATCCGAAATGGACGTGACTTCTTATTG
GCACTGGAGCGCCAGGGCCGCTGTGATGAAAGTAACTTTCGCCAGGTGCTGCAGCTGCTGCGCATCATC
ACTCGCCACGACCTGCTGCCCTACGTCACCCTCAAGAGGAGACGGGCTGTGTGCCCTGATCTTGTAGAC
AAGTATCTGGAGGAGACATCAATTCGCTATGTGACCCCCAGAGCCCTCAGTGATCCAGAACCAAGGCCT
CCCCAGCCCTCTAAAACAGTGCCTCCCCACTATCCTGTGGTGTGTTGCCCCACTTCGGGTCCTCAGATG
TGTAGCAAGCGGCCAGCCCGAGGGAGAGCCACACTTGGGAGCCAGCGAAAACGCCGGAAGTCAGTGACA
CCAGATCCCAAGGAGAAGCAGACATGTGACATCAGACTGCGGGTTCGGGCTGAATACTGCCAGCATGAG
ACTGCTCTGCAGGGCAATGTCTTCTCTAACAAGCAGGACCCACTTGAGCGCCAGTTTGAGCGCTTTAAC
CAGGCCAACACCATCCTCAAGTCCCGGGACCTGGGCTCCATCATCTGTGACATCAAGTTCTCTGAGCTC
ACCTACCTCGATGCATTCTGGCGTGACTACATCAATGGCTCTTTATTAGAGGCACTTAAAGGTGTCTTC
ATCACAGACTCCCTCAAGCAAGCTGTGGGCCATGAAGCCATCAAGCTGCTGGTAAATGTAGACGAGGAG
GACTATGAGCTGGGCCGACAGAAACTCCTGAGGAACTTGATGCTGCAAGCATTGCCCTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001039712
Insert Size 957 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001039712.1
RefSeq Size 2300 bp
RefSeq ORF 957 bp
Locus ID 9191
UniProt ID O75618
Protein Families Druggable Genome, Transcription Factors
MW 36.8 kDa
Gene Summary This gene encodes a protein that contains a death effector domain (DED). DED is a protein-protein interaction domain shared by adaptors, regulators and executors of the programmed cell death pathway. Overexpression of this gene was shown to induce weak apoptosis. Upon stimulation, this protein was found to translocate from cytoplasm to nucleus and colocalize with UBTF, a basal factor required for RNA polymerase I transcription, in the nucleolus. At least three transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (4) differs in the 5' UTR and uses an alternate in-frame splice junction compared to variant 5. The resulting isoform (b) has the same N- and C-termini but is shorter compared to isoform a. Variants 1, 3, and 4 all encode the same isoform (b).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...