United States
Germany
Japan
United Kingdom
China
AP1S3 (NM_001039569) Human Untagged Clone
CAT＃: SC310773
AP1S3 (untagged)-Human adaptor-related protein complex 1, sigma 3 subunit (AP1S3)
CNY 3,990.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | PSORS15; sigma1C |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>SC310773 representing NM_001039569.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGATACATTTCATATTGCTCTTCAGTCGACAAGGGAAATTACGGCTACAGAAATGGTACATCACTCTC CCTGATAAAGAGAGGAAGAAGATCACCCGGGAAATTGTTCAGATTATTCTCTCCCGTGGTCACAGGACA AGCAGTTTTGTTGACTGGAAGGAGCTAAAACTTGTTTATAAAAGGTATGCTAGTTTATATTTTTGCTGT GCAATAGAAAATCAGGACAATGAGCTCTTGACGCTAGAGATTGTGCATCGTTACGTGGAGCTGCTGGAC AAATATTTTGGAAATGTCTGTGAGCTGGATATTATCTTTAATTTTGAAAAGGCTTATTTCATCCTGGAC GAGTTTATAATAGGTGGGGAAATTCAGGAAACATCCAAGAAAATTGCTGTCAAAGCCATTGAAGACTCT GATATGTTACAGGAGACAATGGAAGAATACATGAACAAGCCTACATTTTAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_001039569 |
| Insert Size | 465 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_001039569.1 |
| RefSeq Size | 4005 bp |
| RefSeq ORF | 465 bp |
| Locus ID | 130340 |
| UniProt ID | Q96PC3 |
| Protein Pathways | Lysosome |
| MW | 18.5 kDa |
| Gene Summary | This gene encodes a member of the adaptor-related protein complex 1, sigma subunit genes. The encoded protein is a component of adaptor protein complex 1 (AP-1), one of the AP complexes involved in claathrin-mediated vesicular transport from the Golgi or endosomes. Disruption of the pathway for display of HIV-1 antigens, which prevents recognition of the virus by cytotoxic T cells, has been shown to involve the AP-1 complex (PMID: 15569716). Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2014] Transcript Variant: This variant (1) encodes the functional protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC220329 | AP1S3 (Myc-DDK-tagged)-Human adaptor-related protein complex 1, sigma 3 subunit (AP1S3) |
CNY 1,200.00 |
|
| RC220329L3 | Lenti ORF clone of Human adaptor-related protein complex 1, sigma 3 subunit (AP1S3), Myc-DDK-tagged |
CNY 5,890.00 |
|
| RC220329L4 | Lenti ORF clone of Human adaptor-related protein complex 1, sigma 3 subunit (AP1S3), mGFP tagged |
CNY 5,890.00 |
|
| RG220329 | AP1S3 (tGFP-tagged) - Human adaptor-related protein complex 1, sigma 3 subunit (AP1S3) |
CNY 4,370.00 |
