U2AF1L3 (U2AF1L4) (NM_001040425) Human Untagged Clone
CAT#: SC310723
U2AF1L4 (untagged)-Human U2 small nuclear RNA auxiliary factor 1-like 4 (U2AF1L4), transcript variant 1
CNY 3,990.00
Product images
CNY 1,999.00
CNY 2,700.00
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | U2AF1-RS3; U2AF1L3; U2AF1L3V1; U2AF1RS3; U2af26 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC310723 representing NM_001040425.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGGCTGAATATTTAGCTTCGATATTCGGGACTGAGAAGGACAAGGTTAACTGCTCTTTTTACTTTAAG ATCGGGGTCTGCCGGCACGGGGACCGGTGCTCCCGGCTTCACAACAAGCCGACATTCAGCCAGGAGGTG TTCACAGAACTGCAGGAGAAGTATGGGGAGATTGAAGAGATGAATGTGTGCGACAACCTTGGGGACCAC CTCGTGGGCAACGTCTATGTCAAGTTCCGGAGGGAGGAGGATGGAGAGCGGGCCGTGGCTGAACTCAGT AACCGCTGGTTCAACGGGCAGGCTGTGCACGGTGAGCTGTCTCCTGTCACTGACTTCCGGGAGTCATGC TGTCGCCAGTATGAGATGGGGGAATGTACCCGAGGTGGCTTCTGCAACTTCATGCATCTGCGGCCCATT TCCCAGAACCTCCAGAGGCAGCTCTATGGGCGGGGACCCAGGCGCAGGTCACCCCCGAGGTTCCATACT GGCCACCATCCCCGAGAGAGGAACCATCGGTGTTCCCCTGATCACTGGCATGGCCGCTTCTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_001040425 |
Insert Size | 546 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001040425.2 |
RefSeq Size | 799 bp |
RefSeq ORF | 546 bp |
Locus ID | 199746 |
UniProt ID | Q8WU68 |
MW | 21.3 kDa |
Gene Summary | RNA-binding protein that function as a pre-mRNA splicing factor. Plays a critical role in both constitutive and enhancer-dependent splicing by mediating protein-protein interactions and protein-RNA interactions required for accurate 3'-splice site selection. Acts by enhancing the binding of U2AF2 to weak pyrimidine tracts. Also participates in the regulation of alternative pre-mRNA splicing. Activates exon 5 skipping of PTPRC during T-cell activation; an event reversed by GFI1. Binds to RNA at the AG dinucleotide at the 3'-splice site (By similarity). Shows a preference for AGC or AGA (By similarity).[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (1) has an alternate splice site in the coding region, which results in reading frameshift, compared to variant 2. The resulting isoform (1) is shorter and has a distinct C-terminus, compared to isoform 2. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC224893 | U2AF1L4 (Myc-DDK-tagged)-Human U2 small nuclear RNA auxiliary factor 1-like 4 (U2AF1L4), transcript variant 1 |
CNY 2,400.00 |
|
RC224893L3 | Lenti ORF clone of Human U2 small nuclear RNA auxiliary factor 1-like 4 (U2AF1L4), transcript variant 1, Myc-DDK-tagged |
CNY 5,890.00 |
|
RC224893L4 | Lenti ORF clone of Human U2 small nuclear RNA auxiliary factor 1-like 4 (U2AF1L4), transcript variant 1, mGFP tagged |
CNY 5,890.00 |
|
RG224893 | U2AF1L4 (tGFP-tagged) - Human U2 small nuclear RNA auxiliary factor 1-like 4 (U2AF1L4), transcript variant 1 |
CNY 4,370.00 |
其它U2AF1L4产品