Bim (BCL2L11) (NM_006538) Human Untagged Clone

CAT#: SC310674

BCL2L11 (untagged)-Human BCL2-like 11 (apoptosis facilitator) (BCL2L11), transcript variant 6



  "NM_006538" in other vectors (4)

CNY 3,990.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
BCL2L11 mouse monoclonal antibody,clone OTI2H5
    • 100 ul

CNY 1,999.00
CNY 2,700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms BAM; BIM; BOD
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>NCBI ORF sequence for NM_006538, the custom clone sequence may differ by one or more nucleotides


ATGGCAAAGCAACCTTCTGATGTAAGTTCTGAGTGTGACCGAGAAGGTAGACAATTGCAGCCTGCGGAGA
GGCCTCCCCAGCTCAGACCTGGGGCCCCTACCTCCCTACAGACAGAGCCACAAGACAGGAGCCCAGCACC
CATGAGTTGTGACAAATCAACACAAACCCCAAGTCCTCCTTGCCAGGCCTTCAACCACTATCTCAGTGCA
ATGGCTTCCATGAGGCAGGCTGAACCTGCAGATATGCGCCCAGAGATATGGATCGCCCAAGAGTTGCGGC
GTATTGGAGACGAGTTTAACGCTTACTATGCAAGGAGGGTATTTTTGAATAATTACCAAGCAGCCGAAGA
CCACCCACGAATGGTTATCTTACGACTGTTACGTTACATTGTCCGCCTGGTGTGGAGAATGCATTGA


>OriGene 5' read for NM_006538 unedited
NGACGTCAAATTTGTATACGACTCATATAGGGCGGCCGCGATTCCAAATGGCAAAGCAAC
CTTCTGATGTAAGTTCTGAGTGTGACCGAGAAGGTAGACAATTGCAGCCTGCGGAGAGGC
CTCCCCAGCTCAGACCTGGGGCCCCTACCTCCCTACAGACAGAGCCACAAGACAGGAGCC
CAGCACCCATGAGTTGTGACAAATCAACACAAACCCCAAGTCCTCCTTGCCAGGCCTTCA
ACCACTATCTCAGTGCAATGGCTTCCATGAGGCAGGCTGAACCTGCAGATATGCGCCCAG
AGATATGGATCGCCCAAGAGTTGCGGCGTATTGGAGACGAGTTTAACGCTTACTATGCAA
GGAGGGTATTTTTGAATAATTACCAAGCAGCCGAAGACCACCCACGAATGGTTATCTTAC
GACTGTTACGTTACATTGTCCGCCTGGTGTGGAGAATGCATTGACTCGACTCTAGATTGC
GGCCGCGGTCATAGCTGTTTCCTGAACAGATCCCGGGTGGCATCCCTGTGACCCCTCCCC
AGTGCCTCTCCTGGCCCTGGAAGTTGCCACTCCAGTGCCCACCAGCCTTGTCCTAATAAA
ATTAAGTTGCATCATTTTGTCTGACTAGGTGTCCTTCTATAATATTATGGGGTGGAGGGG
GGGTGGTATNGGANCAAGGGGCANGTTGGGAAGACAACCTGTAAGGCCTGCGGGGTCTAT
TGGGAACCAAACTGGAGTGCAGGGGCACAATCTTGGCTCAATGCAATCTCCGCCTCCTGG
GTTCAGCGATTCTCCTGCCTCAACCTCCCCATTTGTGGGATTCCCAGCATGCATGACCGG
CCAAACTAATTTTTGTTTTTTTGTAAAGAACGGGTTTCACCATATGG
Restriction Sites Please inquire     
ACCN NM_006538
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_006538.2, NP_006529.1
RefSeq Size 3242 bp
RefSeq ORF 417 bp
Locus ID 10018
UniProt ID O43521
Protein Families Druggable Genome
Gene Summary The protein encoded by this gene belongs to the BCL-2 protein family. BCL-2 family members form hetero- or homodimers and act as anti- or pro-apoptotic regulators that are involved in a wide variety of cellular activities. The protein encoded by this gene contains a Bcl-2 homology domain 3 (BH3). It has been shown to interact with other members of the BCL-2 protein family and to act as an apoptotic activator. The expression of this gene can be induced by nerve growth factor (NGF), as well as by the forkhead transcription factor FKHR-L1, which suggests a role of this gene in neuronal and lymphocyte apoptosis. Transgenic studies of the mouse counterpart suggested that this gene functions as an essential initiator of apoptosis in thymocyte-negative selection. Several alternatively spliced transcript variants of this gene have been identified. [provided by RefSeq, Jun 2013]
Transcript Variant: This variant (6, also known as BimL) lacks an in-frame segment in the 5' coding coding region, compared to variant 1. The resulting isoform (6) is shorter, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...