PSME1 (NM_176783) Human Untagged Clone

CAT#: SC310599

PSME1 (untagged)-Human proteasome (prosome, macropain) activator subunit 1 (PA28 alpha) (PSME1), transcript variant 2



  "NM_176783" in other vectors (4)

CNY 3,990.00


货期*
5周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit anti-PSME1 Polyclonal Antibody
    • 100 ul

CNY 1,999.00
CNY 2,700.00

热销推荐


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms HEL-S-129m; IFI5111; PA28A; PA28alpha; REGalpha
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_176783, the custom clone sequence may differ by one or more nucleotides
ATGGCCATGCTCAGGGTCCAGCCCGAGGCCCAAGCCAAGGTGGATGTGTTTCGTGAAGAC
CTCTGTACCAAGACAGAGAACCTGCTCGGGAGCTATTTCCCCAAGAAGATTTCTGAGCTG
GATGCATTTTTAAAGGAGCCAGCTCTCAATGAAGCCAACTTGAGCAATCTGAAGGCCCCA
TTGGACATCCCAGTGCCTGATCCAGTCAAGGAGAAAGAGAAAGAGGAGCGGAAGAAACAG
CAGGAGAAGGAAGACAAGGATGAAAAGAAGAAGGGGGAGGATGAAGACAAAGGTCCTCCC
TGTGGCCCAGTGAACTGCAATGAAAAGATCGTGGTCCTTCTGCAGCGCTTGAAGCCTGAG
ATCAAGGATGTCATTGAGCAGCTCAACCTGGTCACCACCTGGTTGCAGCTGCAGATACCT
CGGATTGAGGATGGTAACAATTTTGGAGTGGCTGTCCAGGAGAAGGTGTTTGAGCTGATG
ACCAGCCTCCACACCAAGCTAGAAGGCTTCCACACTCAAATCTCTAAGTATTTCTCTGAG
CGTGGTGATGCAGTGACTAAAGCAGCCAAGCAGCCCCATGTGGGTGATTATCGGCAGCTG
GTGCACGAGCTGGATGAGGCAGAGTACCGGGACATCCGGCTGATGGTCATGGAGATCCGC
AATGCTTATGTGAGGAGGCAAGGGCAGGGCAGGGGTGGGCAGAGGCAGCTTTCCCAGGCC
ACCCACTCCCTGACCCTGCAGGCTAGGGGTTAA
Restriction Sites Please inquire     
ACCN NM_176783
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_176783.1, NP_788955.1
RefSeq Size 1187 bp
RefSeq ORF 753 bp
Locus ID 5720
Protein Pathways Antigen processing and presentation, Proteasome
Gene Summary The 26S proteasome is a multicatalytic proteinase complex with a highly ordered structure composed of 2 complexes, a 20S core and a 19S regulator. The 20S core is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. The 19S regulator is composed of a base, which contains 6 ATPase subunits and 2 non-ATPase subunits, and a lid, which contains up to 10 non-ATPase subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. An essential function of a modified proteasome, the immunoproteasome, is the processing of class I MHC peptides. The immunoproteasome contains an alternate regulator, referred to as the 11S regulator or PA28, that replaces the 19S regulator. Three subunits (alpha, beta and gamma) of the 11S regulator have been identified. This gene encodes the alpha subunit of the 11S regulator, one of the two 11S subunits that is induced by gamma-interferon. Three alpha and three beta subunits combine to form a heterohexameric ring. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
Transcript Variant: This variant (2) contains an alternate 3' structure, and thus differs in the 3' coding region and 3' UTR, compared to variant 1. The encoded isoform (3) has a distinct and longer C-terminus, compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...