MTHFD2 (NM_006636) Human Untagged Clone
CAT#: SC310521
MTHFD2 (untagged)-Human methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 2, methenyltetrahydrofolate cyclohydrolase (MTHFD2), nuclear gene encoding mitochondrial protein, transcript variant 1
CNY 5,700.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | NMDMC |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC310521 representing NM_006636.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGGCTGCGACTTCTCTAATGTCTGCTTTGGCTGCCCGGCTGCTGCAGCCCGCGCACAGCTGCTCCCTT CGCCTTCGCCCTTTCCACCTCGCGGCAGTTCGAAATGAAGCTGTTGTCATTTCTGGAAGGAAACTGGCC CAGCAGATCAAGCAGGAAGTGCGGCAGGAGGTAGAAGAGTGGGTGGCCTCAGGCAACAAACGGCCACAC CTGAGTGTGATCCTGGTTGGCGAGAATCCTGCAAGTCACTCCTATGTCCTCAACAAAACCAGGGCAGCT GCAGTTGTGGGAATCAACAGTGAGACAATTATGAAACCAGCTTCAATTTCAGAGGAAGAATTGTTGAAT TTAATCAATAAACTGAATAATGATGATAATGTAGATGGCCTCCTTGTTCAGTTGCCTCTTCCAGAGCAT ATTGATGAGAGAAGGATCTGCAATGCTGTTTCTCCAGACAAGGATGTTGATGGCTTTCATGTAATTAAT GTAGGACGAATGTGTTTGGATCAGTATTCCATGTTACCGGCTACTCCATGGGGTGTGTGGGAAATAATC AAGCGAACTGGCATTCCAACCCTAGGGAAGAATGTGGTTGTGGCTGGAAGGTCAAAAAACGTTGGAATG CCCATTGCAATGTTACTGCACACAGATGGGGCGCATGAACGTCCCGGAGGTGATGCCACTGTTACAATA TCTCATCGATATACTCCCAAAGAGCAGTTGAAGAAACATACAATTCTTGCAGATATTGTAATATCTGCT GCAGGTATTCCAAATCTGATCACAGCAGATATGATCAAGGAAGGAGCAGCAGTCATTGATGTGGGAATA AATAGAGTTCACGATCCTGTAACTGCCAAACCCAAGTTGGTTGGAGATGTGGATTTTGAAGGAGTCAGA CAAAAAGCTGGGTATATCACTCCAGTTCCTGGAGGTGTTGGCCCCATGACAGTGGCAATGCTAATGAAG AATACCATTATTGCTGCAAAAAAGGTGCTGAGGCTTGAAGAGCGAGAAGTGCTGAAGTCTAAAGAGCTT GGGGTAGCCACTAATTAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_006636 |
Insert Size | 1053 bp |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_006636.3 |
RefSeq Size | 2208 bp |
RefSeq ORF | 1053 bp |
Locus ID | 10797 |
UniProt ID | P13995 |
Domains | THF_DHG_CYH |
Protein Families | Druggable Genome |
Protein Pathways | Glyoxylate and dicarboxylate metabolism, Metabolic pathways, One carbon pool by folate |
MW | 37.9 kDa |
Gene Summary | This gene encodes a nuclear-encoded mitochondrial bifunctional enzyme with methylenetetrahydrofolate dehydrogenase and methenyltetrahydrofolate cyclohydrolase activities. The enzyme functions as a homodimer and is unique in its absolute requirement for magnesium and inorganic phosphate. Formation of the enzyme-magnesium complex allows binding of NAD. Alternative splicing results in two different transcripts, one protein-coding and the other not protein-coding. This gene has a pseudogene on chromosome 7. [provided by RefSeq, Mar 2009] Transcript Variant: This variant (1) represents the shorter transcript and is the protein-coding transcript. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC202143 | MTHFD2 (Myc-DDK-tagged)-Human methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 2, methenyltetrahydrofolate cyclohydrolase (MTHFD2), nuclear gene encoding mitochondrial protein, tra |
CNY 5,488.00 |
|
RC202143L1 | Lenti ORF clone of Human methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 2, methenyltetrahydrofolate cyclohydrolase (MTHFD2), nuclear gene encoding mitochondrial protein, tra, Myc-DDK-tagged |
CNY 7,888.00 |
|
RC202143L2 | Lenti ORF clone of Human methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 2, methenyltetrahydrofolate cyclohydrolase (MTHFD2), nuclear gene encoding mitochondrial protein, tra, mGFP tagged |
CNY 5,890.00 |
|
RC202143L3 | Lenti ORF clone of Human methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 2, methenyltetrahydrofolate cyclohydrolase (MTHFD2), nuclear gene encoding mitochondrial protein, tra, Myc-DDK-tagged |
CNY 5,890.00 |
|
RC202143L4 | Lenti ORF clone of Human methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 2, methenyltetrahydrofolate cyclohydrolase (MTHFD2), nuclear gene encoding mitochondrial protein, tra, mGFP tagged |
CNY 5,890.00 |
|
RG202143 | MTHFD2 (tGFP-tagged) - Human methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 2, methenyltetrahydrofolate cyclohydrolase (MTHFD2), nuclear gene encoding mitochondrial protein, transcr |
CNY 7,088.00 |
|
SC317553 | MTHFD2 (untagged)-Human methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 2, methenyltetrahydrofolate cyclohydrolase (MTHFD2), nuclear gene encoding mitochondrial protein, transcript variant 1 |
CNY 5,700.00 |
|
SC323742 | MTHFD2 (untagged)-Human methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 2, methenyltetrahydrofolate cyclohydrolase (MTHFD2), nuclear gene encoding mitochondrial protein, transcript variant 1 |
CNY 5,488.00 |