MEF2B (BORCS8-MEF2B) (NM_005919) Human Untagged Clone

CAT#: SC310487

MEF2BNB (untagged)-Human MEF2BNB-MEF2B readthrough (MEF2BNB-MEF2B), transcript variant 1



  "NM_005919" in other vectors (5)

CNY 3,656.00

CNY 7,220.00


货期*
现货

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


Rabbit Polyclonal Anti-MEF2B Antibody
    • 50 ug

CNY 5,250.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms LOC729991-MEF2B; MEF2B; MEF2BNB-MEF2B; RSRFR2
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene sequence for NM_005919 edited
CATCAGCATCCGGGACCATATGAATGCCAGTGCCCAGGGCCACAGCCCGGAGGAACCACC
CCCGCCCTCCTCAGCCTGATCCTGGAAGAGACTCGGGGCCCCCCAGCCTCCGCCAACCCA
GACAAAGATCATTCCACTCAGCCTGGGACGATGGGGAGGAAAAAAATCCAGATCTCCCGC
ATCCTGGACCAAAGGAATCGGCAGGTGACGTTCACCAAGCGGAAGTTCGGGCTGATGAAG
AAGGCCTATGAGCTGAGCGTGCTCTGTGACTGTGAGATAGCCCTCATCATCTTCAACAGC
GCCAACCGCCTCTTCCAGTATGCCAGCACGGACATGGACCGTGTGCTGCTGAAGTACACA
GAGTACAGCGAGCCCCACGAGAGCCGCACCAACACTGACATCCTCGAGACGCTGAAGCGG
AGGGGCATTGGCCTCGATGGGCCAGAGCTGGAGCCGGATGAAGGGCCTGAGGAGCCAGGA
GAGAAGTTTCGGAGGCTGGCAGGCGAAGGGGGTGATCCGGCCTTGCCCCGACCCCGGCTG
TATCCTGCAGCTCCTGCTATGCCCAGCCCAGATGTGGTATACGGGGCCTTACCGCCACCA
GGCTGTGACCCCAGTGGGCTTGGGGAAGCACTGCCCGCCCAGAGCCGCCCATCTCCCTTC
CGACCAGCAGCCCCCAAAGCCGGGCCCCCAGGCCTGGTGCACCCTCTCTTCTCACCAAGC
CACCTCACCAGCAAGACACCACCCCCACTGTACCTGCCGACGGAAGGGCGGAGGTCAGAC
CTGCCTGGTGGCCTGGCTGGGCCCCGAGGGGGACTAAACACCTCCAGAAGCCTCTACAGT
GGCCTGCAGAACCCCTGCTCCACTGCAACTCCCGGACCCCCACTGGGGAGCTTCCCCTTC
CTCCCCGGAGGCCCCCCAGTGGGGGCCGAAGCCTGGGCGAGGAGGGTCCCCCAACCCGCG
GCGCCTCCCCGCCGACCCCCCCAGTCAGCATCAAGTCTGAGCGCCTCTCTCCGGCCCCCG
GGGGCCCCGGCGACTTTCCTAAGACCTTCCCCTATCCCTTGCTCCTCGCCCGGTCCCTGG
CAGAGCCTCTGCGGCCTGGGCCCGCCCTGCGCCGGCTGCCCTTGGCCGACGGCTGGCCCC
GGTAGGAGATCACCCGGTGGCACCAGCCCAGAGCGCTCGCCAGGTACGGCGAGGGCACGT
GGGGACCCCACCTCCCTCCAGGCCTCTTCAGAGAAGACCCAACAGTGACGCCCCCCTCCG
CGGTGGGGGCTTGGAGGTGGGCGGCTGGACTCAATCCACCCTGGGGGGCTCCTTTCCTTC
TTCCTATTTGTGTGTATATCCACAAATAAAACGCGCGT
Restriction Sites Please inquire     
ACCN NM_005919
Insert Size 1300 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation The ORF of this clone has been fully sequenced and found to be a perfect match to NM_005919.1.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_005919.1, NP_005910.1
RefSeq Size 1671 bp
RefSeq ORF 1098 bp
Locus ID 4207
UniProt ID Q02080
Domains MADS
Protein Families Transcription Factors
Gene Summary This gene represents numerous read-through transcripts that span GeneID:729991 and 100271849. Many read-through transcripts are predicted to be nonsense-mediated decay (NMD) candidates, and are thought to be non-coding. Some transcripts are predicted to be capable of translation reinitiation at a downstream AUG, resulting in expression of at least one isoform of myocyte enhancer factor 2B (MEF2B) from this read-through locus. At least one additional MEF2B variant and isoform can be expressed from a downstream promoter, and is annotated on GeneID:100271849. [provided by RefSeq, Oct 2010]
Transcript Variant: This variant (1) lacks two alternate exons in the 5' region and one alternate exon in the 3' region, compared to variant 2. This variant is thought to be protein coding because translation can reinitiate at the downstream AUG, resulting in expression of an isoform of MEF2B (geneID:100271849). Isoform b has a shorter and distinct C-terminus, compared to MEF2A isoform a (NP_001139257.1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...