SETD7 (NM_030648) Human Untagged Clone

CAT#: SC310486

SETD7 (untagged)-Human SET domain containing (lysine methyltransferase) 7 (SETD7)



  "NM_030648" in other vectors (6)

CNY 5,488.00


货期*
现货

规格
    • 10 ug

Product images

经常一起买 (3)
SETD7 mouse monoclonal antibody, clone OTI2D10 (formerly 2D10)
    • 100 ul

CNY 1,999.00
CNY 2,700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms KMT7; SET7; SET7/9; SET9
Vector pCMV6-XL6
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>NCBI ORF sequence for NM_030648, the custom clone sequence may differ by one or more nucleotides


ATGGATAGCGACGACGAGATGGTGGAGGAGGCGGTGGAAGGGCACCTGGACGATGACGGATTACCGCACG
GGTTCTGCACAGTCACCTACTCCTCCACAGACAGATTTGAGGGGAACTTTGTTCACGGAGAAAAGAACGG
ACGGGGGAAGTTCTTCTTCTTTGATGGCAGCACCCTGGAGGGGTATTATGTGGATGATGCCTTGCAGGGC
CAGGGAGTTTACACTTACGAAGATGGGGGAGTTCTCCAGGGCACGTATGTAGACGGAGAGCTGAACGGTC
CAGCCCAGGAATATGACACAGATGGGAGACTGATCTTCAAGGGGCAGTATAAAGATAACATTCGTCATGG
AGTGTGCTGGATATATTACCCAGATGGAGGAAGCCTTGTAGGAGAAGTAAATGAAGATGGGGAGATGACT
GGAGAGAAGATAGCCTATGTGTACCCTGATGAGAGGACCGCACTTTATGGGAAATTTATTGATGGAGAGA
TGATAGAAGGCAAACTGGCTACCCTTATGTCCACTGAAGAAGGGAGGCCTCACTTTGAACTGATGCCTGG
AAATTCAGTGTACCACTTTGATAAGTCGACTTCATCTTGCATTTCTACCAATGCTCTTCTTCCAGATCCT
TATGAATCAGAAAGGGTTTATGTTGCTGAATCTCTTATTTCCAGTGCTGGAGAAGGACTTTTTTCAAAGG
TAGCTGTGGGACCTAATACTGTTATGTCTTTTTATAATGGAGTTCGAATTACACACCAAGAGGTTGACAG
CAGGGACTGGGCCCTTAATGGGAACACCCTCTCCCTTGATGAAGAAACGGTCATTGATGTGCCTGAGCCC
TATAACCACGTATCCAAGTACTGTGCCTCCTTGGGACACAAGGCAAATCACTCCTTCACTCCAAACTGCA
TCTACGATATGTTTGTCCACCCCCGTTTTGGGCCCATCAAATGCATCCGCACCCTGAGAGCAGTGGAGGC
CGATGAAGAGCTCACCGTTGCCTATGGCTATGACCACAGCCCCCCCGGGAAGAGTGGGCCTGAAGCCCCT
GAGTGGTACCAGGTGGAGCTGAAGGCCTTCCAGGCCACCCAGCAAAAGTGA


Restriction Sites NotI-NotI     
ACCN NM_030648
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation The open reading frame of this TrueClone was fully sequenced and found to be a perfect match to the protein associated to this reference.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_030648.2, NP_085151.1
RefSeq Size 7012 bp
RefSeq ORF 1101 bp
Locus ID 80854
UniProt ID Q8WTS6
Domains SET, MORN
Protein Families Druggable Genome
Protein Pathways Lysine degradation
Gene Summary Histone methyltransferase that specifically monomethylates 'Lys-4' of histone H3. H3 'Lys-4' methylation represents a specific tag for epigenetic transcriptional activation. Plays a central role in the transcriptional activation of genes such as collagenase or insulin. Recruited by IPF1/PDX-1 to the insulin promoter, leading to activate transcription. Has also methyltransferase activity toward non-histone proteins such as p53/TP53, TAF10, and possibly TAF7 by recognizing and binding the [KR]-[STA]-K in substrate proteins. Monomethylates 'Lys-189' of TAF10, leading to increase the affinity of TAF10 for RNA polymerase II. Monomethylates 'Lys-372' of p53/TP53, stabilizing p53/TP53 and increasing p53/TP53-mediated transcriptional activation.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (1) represents the longest transcript and encodes the longest isoform (1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...