CAMK2D (NM_001221) Human Untagged Clone

CAT#: SC310318

CAMK2D (untagged)-Human calcium/calmodulin-dependent protein kinase II delta (CAMK2D), transcript variant 3



  "NM_001221" in other vectors (7)

CNY 5,488.00


货期*
现货

规格
    • 10 ug

Product images

经常一起买 (3)
Rabbit Polyclonal antibody to CaMKII delta (calcium/calmodulin-dependent protein kinase II delta)
    • 100 ul

CNY 6,281.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms CAMKD
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>OriGene sequence for NM_001221 edited
ATGGCTTCGACCACAACCTGCACCAGGTTCACGGACGAGTATCAGCTTTTCGAGGAGCTT
GGAAAGGGGGCATTCTCAGTGGTGAGAAGATGTATGAAAATTCCTACTGGACAAGAATAT
GCTGCCAAAATTATCAACACCAAAAAGCTTTCTGCTAGGGATCATCAGAAACTAGAAAGA
GAAGCTAGAATCTGCCGTCTTTTGAAGCACCCTAATATTGTGCGACTTCATGATAGCATA
TCAGAAGAGGGCTTTCACTACTTGGTGTTTGATTTAGTTACTGGAGGTGAACTGTTTGAA
GACATAGTGGCAAGAGAATACTACAGTGAAGCTGATGCCAGTCATTGTATACAGCAGATT
CTAGAAAGTGTTAATCATTGTCACCTAAATGGCATAGTTCACAGGGACCTGAAGCCTGAG
AATTTGCTTTTAGCTAGCAAATCCAAGGGAGCAGCTGTGAAATTGGCAGACTTTGGCTTA
GCCATAGAAGTTCAAGGGGACCAGCAGGCGTGGTTTGGTTTTGCTGGCACACCTGGATAT
CTTTCTCCAGAAGTTTTACGTAAAGATCCTTATGGAAAGCCAGTGGATATGTGGGCATGT
GGTGTCATTCTCTATATTCTACTTGTGGGGTATCCACCCTTCTGGGATGAAGACCAACAC
AGACTCTATCAGCAGATCAAGGCTGGAGCTTATGATTTTCCATCACCAGAATGGGACACG
GTGACTCCTGAAGCCAAAGACCTCATCAATAAAATGCTTACTATCAACCCTGCCAAACGC
ATCACAGCCTCAGAGGCACTGAAGCACCCATGGATCTGTCAACGTTCTACTGTTGCTTCC
ATGATGCACAGACAGGAGACTGTAGACTGCTTGAAGAAATTTAATGCTAGAAGAAAACTA
AAGGGTGCCATCTTGACAACTATGCTGGCTACAAGGAATTTCTCAGCAGCCAAGAGTTTG
TTGAAGAAACCAGATGGAGTAAAGGAGTCAACTGAGAGTTCAAATACAACAATTGAGGAT
GAAGATGTGAAAGCACGAAAGCAAGAGATTATCAAAGTCACTGAACAACTGATCGAAGCT
ATCAACAATGGGGACTTTGAAGCCTACACAAAAATCTGTGACCCAGGCCTTACTGCTTTT
GAACCTGAAGCTTTGGGTAATTTAGTGGAAGGGATGGATTTTCACCGATTCTACTTTGAA
AATGCTTTGTCCAAAAGCAATAAACCAATCCACACTATTATTCTAAACCCTCATGTACAT
CTGGTAGGGGATGATGCCGCCTGCATAGCATATATTAGGCTCACACAGTACATGGATGGC
AGTGGAATGCCAAAGACAATGCAGTCAGAAGAGACTCGTGTGTGGCACCGCCGGGATGGA
AAGTGGCAGAATGTTCATTTTCATCGCTCGGGGTCACCAACAGTACCCATCAAGCCACCC
TGTATTCCAAATGGGAAAGAAAACTTCTCAGGAGGCACCTCTTTGTGGCAAAACATCTAA
Restriction Sites Please inquire     
ACCN NM_001221
Insert Size 1500 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001221.2, NP_001212.2
RefSeq Size 2140 bp
RefSeq ORF 1500 bp
Locus ID 817
UniProt ID Q13557
Domains pkinase, TyrKc, S_TKc
Protein Families Druggable Genome, Protein Kinase
Protein Pathways Calcium signaling pathway, ErbB signaling pathway, Glioma, GnRH signaling pathway, Long-term potentiation, Melanogenesis, Neurotrophin signaling pathway, Olfactory transduction, Oocyte meiosis, Wnt signaling pathway
Gene Summary The product of this gene belongs to the serine/threonine protein kinase family and to the Ca(2+)/calmodulin-dependent protein kinase subfamily. Calcium signaling is crucial for several aspects of plasticity at glutamatergic synapses. In mammalian cells, the enzyme is composed of four different chains: alpha, beta, gamma, and delta. The product of this gene is a delta chain. Alternative splicing results in multiple transcript variants encoding distinct isoforms. Distinct isoforms of this chain have different expression patterns.[provided by RefSeq, Nov 2008]
Transcript Variant: This variant (3) represents the longest transcript and encodes the longest isoform (3). Sequence Note: The RefSeq transcript and protein were derived from transcript and genomic sequence to make the sequence consistent with the reference genome assembly. The extend of this RefSeq trasncript is supported by transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...