KCNC1 (NM_004976) Human Untagged Clone

CAT#: SC310304

KCNC1 (untagged)-Human potassium voltage-gated channel, Shaw-related subfamily, member 1 (KCNC1), transcript variant B



  "NM_004976" in other vectors (6)

CNY 5,720.00


货期*
现货

规格
    • 10 ug

Product images

经常一起买 (3)
Anti-KCNC1 Rabbit Polyclonal Antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms EPM7; KV3.1; KV4; NGK2
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>SC310304 representing NM_004976.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCCCTTACCCATGGGAGCGGCCGCCAGGGGGAGTTGGCGCCGGGGAGGGGGCCGCGCCATGCCTAAGGG
GGCGCCGCGATGGGCCAAGGGGACGAGAGCGAGCGCATCGTGATCAACGTGGGCGGCACGCGCCACCAG
ACGCACCGCTCGACCCTGCGCACGCTGCCCGGCACGCGGCTCGCCTGGCTGGCGGAGCCCGACGCCCAC
AGCCACTTCGACTATGACCCGCGTGCTGACGAGTTCTTCTTCGACCGCCACCCCGGCGTCTTCGCGCAC
ATCCTGAACTACTACCGCACGGGCAAGCTGCACTGCCCAGCCGACGTGTGCGGGCCGCTCTACGAGGAG
GAGCTGGCCTTCTGGGGCATCGACGAGACCGACGTGGAGCCCTGCTGCTGGATGACGTACCGCCAGCAC
CGCGACGCCGAGGAGGCTCTGGACAGCTTCGGCGGCGCTCCTCTGGACAACAGCGCCGACGACGCGGAC
GCCGACGGCCCTGGCGACTCGGGCGACGGCGAGGACGAGCTGGAGATGACCAAGCGCCTGGCGCTCAGT
GACTCCCCGGATGGCCGGCCTGGCGGCTTTTGGCGCCGCTGGCAGCCGCGCATCTGGGCGCTCTTCGAG
GACCCGTACTCGTCCCGCTACGCGCGGTATGTGGCCTTCGCTTCCCTCTTCTTCATCCTGGTCTCCATC
ACCACCTTCTGCCTGGAGACCCACGAGCGCTTCAACCCCATCGTGAACAAGACGGAGATCGAGAACGTT
CGCAATGGCACGCAAGTGCGCTACTACCGGGAGGCCGAGACGGAGGCCTTCCTTACCTACATCGAGGGC
GTCTGTGTGGTCTGGTTCACCTTCGAGTTCCTCATGCGTGTCATCTTCTGCCCCAACAAGGTAGAGTTC
ATCAAGAACTCGCTCAACATCATTGACTTTGTGGCCATCCTGCCCTTCTACCTGGAGGTGGGGCTGAGC
GGCCTGTCCTCCAAGGCAGCCAAGGACGTGCTGGGCTTCCTGCGCGTCGTCCGCTTCGTGCGCATCTTG
CGCATCTTTAAGCTGACCCGCCACTTTGTGGGCCTGCGGGTCCTGGGCCACACGCTCCGAGCCAGCACC
AACGAGTTCCTGCTGCTCATCATCTTCCTGGCCTTGGGCGTGCTGATCTTCGCCACCATGATCTACTAC
GCCGAGAGGATAGGGGCACAGCCCAATGACCCCAGCGCCAGTGAGCACACGCACTTTAAGAACATCCCC
ATCGGCTTCTGGTGGGCCGTGGTCACCATGACGACCCTGGGCTATGGAGACATGTACCCGCAGACGTGG
TCCGGCATGCTGGTGGGGGCTCTGTGTGCGCTGGCGGGCGTGCTCACCATCGCCATGCCCGTGCCCGTC
ATCGTGAACAATTTCGGGATGTATTACTCCTTAGCCATGGCTAAGCAGAAACTACCAAAGAAAAAAAAG
AAGCATATTCCGCGGCCACCGCAGCTGGGATCTCCCAATTATTGTAAATCTGTCGTAAACTCTCCACAC
CACAGTACTCAGAGTGACACATGTCCGCTGGCCCAGGAAGAAATTTTAGAAATTAACAGAGCAGGTAGG
AAACCTCTTAGAGGCATGTCGATCTGA

Restriction Sites SgfI-MluI     
ACCN NM_004976
Insert Size 1614 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation The ORF of this clone has been fully sequenced and found to contain one SNP compared with NM_004976.2.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_004976.2
RefSeq Size 1602 bp
RefSeq ORF 1614 bp
Locus ID 3746
UniProt ID P48547
Protein Families Druggable Genome, Ion Channels: Potassium, Transmembrane
MW 60.4 kDa
Gene Summary This gene encodes a member of a family of integral membrane proteins that mediate the voltage-dependent potassium ion permeability of excitable membranes. Alternative splicing is thought to result in two transcript variants encoding isoforms that differ at their C-termini. These isoforms have had conflicting names in the literature: the longer isoform has been called both "b" and "alpha", while the shorter isoform has been called both "a" and "beta" (PMIDs 1432046, 12091563). [provided by RefSeq, Oct 2014]
Transcript Variant: This variant (2) lacks two exons and its 3' exon extends past a splice site used in variant 1, resulting in a distinct 3' coding region and 3' UTR, compared to variant 1. The encoded isoform (2) has a shorter and distinct C-terminus, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data because no single transcript was available for the full length of the gene. The extent of this transcript is supported by transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...