United States
Germany
Japan
United Kingdom
China
UBE2J2 (NM_194458) Human Untagged Clone
CAT＃: SC309702
UBE2J2 (untagged)-Human ubiquitin-conjugating enzyme E2, J2 (UBE2J2), transcript variant 3
CNY 3,990.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | NCUBE-2; NCUBE2; PRO2121 |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>NCBI ORF sequence for NM_194458, the custom clone sequence may differ by one or more nucleotides
ATGACCCCTTATGAAGGTGGCTATTATCATGGAAAACTAATTTTTCCCAGAGAATTTCCT TTCAAACCTCCCAGTATCTATATGATCACTCCCAACGGGAGGTTTAAGTGCAACACCAGG CTGTGTCTTTCTATCACGGATTTCCACCCGGACACGTGGAACCCGGCCTGGTCTGTCTCC ACCATCCTGACTGGGCTCCTGAGCTTCATGGTGGAGAAGGGCCCCACCCTGGGCAGTATA GAGACGTCGGACTTCACGAAAAGACAACTGGCAGTGCAGAGTTTAGCATTTAATTTGAAA GATAAAGTCTTTTGTGAATTATTTCCTGAAGTCGTGGAGGAGATTAAACAAAAACAGAAA GCACAAGACGAACTCAGTAGCAGACCCCAGACTCTCCCCTTGCCAGACGTGGTTCCAGAC GGGGAGACGCACCTCGTCCAGAACGGGATTCAGCTGCTCAACGGGCATGCGCCGGGGGCC GTCCCAAACCTCGCAGGGCTCCAGCAGGCCAACCGGCACCACGGACTCCTGGGTGGCGCC CTGGCGAACTTGTTTGTGATAGTTGGGTTTGCAGCCTTTGCTTACACGGTCAAGTACGTG CTGAGGAGCATCGCGCAGGAGTGA |
| Restriction Sites | Please inquire |
| ACCN | NM_194458 |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_194458.1, NP_919440.1 |
| RefSeq Size | 2396 bp |
| RefSeq ORF | 624 bp |
| Locus ID | 118424 |
| UniProt ID | Q8N2K1 |
| Protein Families | Transmembrane |
| Protein Pathways | Parkinson's disease, Ubiquitin mediated proteolysis |
| Gene Summary | The modification of proteins with ubiquitin is an important cellular mechanism for targeting abnormal or short-lived proteins for degradation. Ubiquitination involves at least three classes of enzymes: ubiquitin-activating enzymes, or E1s, ubiquitin-conjugating enzymes, or E2s, and ubiquitin-protein ligases, or E3s. This gene encodes a member of the E2 ubiquitin-conjugating enzyme family. This enzyme is located in the membrane of the endoplasmic reticulum. Multiple alternatively spliced transcript variants have been found for this gene, but the full-length nature of some variants has not been defined. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (3) has two alternate splice sites in the 5' region, as compared to variant 1. It uses a downstream start codon, so the encoded isoform (3) has a shorter N-terminus, as compared to isoform 1. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC219392 | UBE2J2 (Myc-DDK-tagged)-Human ubiquitin-conjugating enzyme E2, J2 (UBE2J2), transcript variant 3 |
CNY 2,400.00 |
|
| RC219392L1 | Lenti ORF clone of Human ubiquitin-conjugating enzyme E2, J2 (UBE2J2), transcript variant 3, Myc-DDK-tagged |
CNY 5,890.00 |
|
| RC219392L2 | Lenti ORF clone of Human ubiquitin-conjugating enzyme E2, J2 (UBE2J2), transcript variant 3, mGFP tagged |
CNY 5,890.00 |
|
| RC219392L3 | Lenti ORF clone of Human ubiquitin-conjugating enzyme E2, J2 (UBE2J2), transcript variant 3, Myc-DDK-tagged |
CNY 5,890.00 |
|
| RC219392L4 | Lenti ORF clone of Human ubiquitin-conjugating enzyme E2, J2 (UBE2J2), transcript variant 3, mGFP tagged |
CNY 5,890.00 |
|
| RG219392 | UBE2J2 (tGFP-tagged) - Human ubiquitin-conjugating enzyme E2, J2 (UBE2J2), transcript variant 3 |
CNY 4,000.00 |
