RNF21 (TRIM34) (NM_130390) Human Untagged Clone

CAT#: SC309657

TRIM34 (untagged)-Human tripartite motif containing 34 (TRIM34), transcript variant 3



  "NM_130390" in other vectors (4)

CNY 6,270.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit Polyclonal Anti-TRIM34 Antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms IFP1; RNF21
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC309657 representing NM_130390.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGCTTCAAAAATCTTGCTTAACGTACAAGAGGAGGTGACCTGTCCCATCTGCCTGGAGCTGTTGACA
GAACCCTTGAGTCTAGACTGTGGCCACAGCCTCTGCCGAGCCTGCATCACTGTGAGCAACAAGGAGGCA
GTGACCAGCATGGGAGGAAAAAGCAGCTGTCCTGTGTGTGGTATCAGTTACTCATTTGAACATCTACAG
GCTAATCAGCATCTGGCCAACATAGTGGAGAGACTCAAGGAGGTCAAGTTGAGCCCAGACAATGGGAAG
AAGAGAGATCTCTGTGATCATCATGGAGAGAAACTCCTACTCTTCTGTAAGGAGGATAGGAAAGTCATT
TGCTGGCTTTGTGAGCGGTCTCAGGAGCACCGTGGTCACCACACAGTCCTCACGGAGGAAGTATTCAAG
GAATGTCAGGAGAAACTCCAGGCAGTCCTCAAGAGGCTGAAGAAGGAAGAGGAGGAAGCTGAGAAGCTG
GAAGCTGACATCAGAGAAGAGAAAACTTCCTGGAAGTATCAGGTACAAACTGAGAGACAAAGGATACAA
ACAGAATTTGATCAGCTTAGAAGCATCCTAAATAATGAGGAGCAGAGAGAGCTGCAAAGATTGGAAGAA
GAAGAAAAGAAGACGCTGGATAAGTTTGCAGAGGCTGAGGATGAGCTAGTTCAGCAGAAGCAGTTGGTG
AGAGAGCTCATCTCAGATGTGGAGTGTCGGAGTCAGTGGTCAACAATGGAGCTGCTGCAGGACATGAGT
GGAATCATGAAATGGTGCGTATGGGTGGCCAGGAGTGGTGCTTGTGAGTTATAA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_130390
Insert Size 813 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_130390.2
RefSeq Size 959 bp
RefSeq ORF 813 bp
Locus ID 53840
UniProt ID Q9BYJ4
Protein Families Druggable Genome
MW 31.4 kDa
Gene Summary The protein encoded by this gene is a member of the tripartite motif (TRIM) family. The TRIM motif includes three zinc-binding domains, a RING, B-box type 1 and B-box type 2 domain, and a coiled-coil region. Expression of this gene is up-regulated by interferon. This gene is mapped to chromosome 11p15, where it resides within a TRIM gene cluster. Alternative splicing results in multiple transcript variants. A read-through transcript from the upstream TRIM6 gene has also been observed, which results in a fusion product from these neighboring family members. [provided by RefSeq, Oct 2010]
Transcript Variant: This variant (3) lacks several 3' exons but includes a unique segment at its 3' end, compared to variant 1. The encoded isoform (3, also known as the short form) has a distinct and shorter C-terminus, compared to isoform 1. The 5' UTR is incomplete due to a lack of 5'-complete transcripts representing this variant and the presence of splicing ambiguity in the 5' region.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...