CCR11 (ACKR4) (NM_178445) Human Untagged Clone
CAT#: SC309654
CCRL1 (untagged)-Human chemokine (C-C motif) receptor-like 1 (CCRL1), transcript variant 1
CNY 3,656.00
CNY 7,220.00
Cited in 1 publication. |
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | CC-CKR-11; CCBP2; CCR-11; CCR10; CCR11; CCRL1; CCX-CKR; CCX CKR; CKR-11; PPR1; VSHK1 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_178445, the custom clone sequence may differ by one or more nucleotides
ATGGCTTTGGAACAGAACCAGTCAACAGATTATTATTATGAGGAAAATGAAATGAATGGC ACTTATGACTACAGTCAATATGAACTGATCTGTATCAAAGAAGATGTCAGAGAATTTGCA AAAGTTTTCCTCCCTGTATTCCTCACAATAGTTTTCGTCATTGGACTTGCAGGCAATTCC ATGGTAGTGGCAATTTATGCCTATTACAAGAAACAGAGAACCAAAACAGATGTGTACATC CTGAATTTGGCTGTAGCAGATTTACTCCTTCTATTCACTCTGCCTTTTTGGGCTGTTAAT GCAGTTCATGGGTGGGTTTTAGGGAAAATAATGTGCAAAATAACTTCAGCCTTGTACACA CTAAACTTTGTCTCTGGAATGCAGTTTCTGGCTTGTATCAGCATAGACAGATATGTGGCA GTAACTAAAGTCCCCAGCCAATCAGGAGTGGGAAAACCATGCTGGATCATCTGTTTCTGT GTCTGGATGGCTGCCATCTTGCTGAGCATACCCCAGCTGGTTTTTTATACAGTAAATGAC AATGCTAGGTGCATTCCCATTTTCCCCCGCTACCTAGGAACATCAATGAAAGCATTGATT CAAATGCTAGAGATCTGCATTGGATTTGTAGTACCCTTTCTTATTATGGGGGTGTGCTAC TTTATCACAGCAAGGACACTCATGAAGATGCCAAACATTAAAATATCTCGACCCCTAAAA GTTCTGCTCACAGTCGTTATAGTTTTCATTGTCACTCAACTGCCTTATAACATTGTCAAG TTCTGCCGAGCCATAGACATCATCTACTCCCTGATCACCAGCTGCAACATGAGCAAACGC ATGGACATCGCCATCCAAGTCACAGAAAGCATCGCACTCTTTCACAGCTGCCTCAACCCA ATCCTTTATGTTTTTATGGGAGCATCTTTCAAAAACTACGTTATGAAAGTGGCCAAGAAA TATGGGTCCTGGAGAAGACAGAGACAAAGTGTGGAGGAGTTTCCTTTTGATTCTGAGGGT CCTACAGAGCCAACCAGTACTTTTAGCATTTAA |
Restriction Sites | Please inquire |
ACCN | NM_178445 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_178445.1, NP_848540.1 |
RefSeq Size | 2402 bp |
RefSeq ORF | 1053 bp |
Locus ID | 51554 |
UniProt ID | Q9NPB9 |
Protein Families | Druggable Genome, GPCR, Transmembrane |
Gene Summary | The protein encoded by this gene is a member of the G protein-coupled receptor family, and is a receptor for C-C type chemokines. This receptor has been shown to bind dendritic cell- and T cell-activated chemokines including CCL19/ELC, CCL21/SLC, and CCL25/TECK. A pseudogene of this gene is found on chromosome 6. Alternatively spliced transcript variants encoding the same protein have been described. [provided by RefSeq, Jul 2013] Transcript Variant: This variant (1) differs in the 5' UTR, as compared to variant 2. Both variants encode the same protein. |
Citations (1)
The use of this cDNA Clones has been cited in the following citations: |
---|
Molecular Interaction of a Potent Nonpeptide Agonist with the Chemokine Receptor CCR8
,PC Jensen, R Nygaard, S Thiele, A Elder, G Zhu, R Kolbeck, S Ghosh, TW Schwartz, and MM Rosenkilde,
Mol Pharmacol. 2007 Aug;72(2):327-40.
[ACKR4]
|
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC224197 | CCRL1 (Myc-DDK-tagged)-Human chemokine (C-C motif) receptor-like 1 (CCRL1), transcript variant 1 |
CNY 5,488.00 |
|
RC224197L3 | Lenti-ORF clone of CCRL1 (Myc-DDK-tagged)-Human chemokine (C-C motif) receptor-like 1 (CCRL1), transcript variant 1 |
CNY 5,890.00 |
|
RC224197L4 | Lenti-ORF clone of CCRL1 (mGFP-tagged)-Human chemokine (C-C motif) receptor-like 1 (CCRL1), transcript variant 1 |
CNY 5,890.00 |
|
RG224197 | CCRL1 (tGFP-tagged) - Human chemokine (C-C motif) receptor-like 1 (CCRL1), transcript variant 1 |
CNY 4,370.00 |