RHCE (NM_138618) Human Untagged Clone

CAT#: SC309558

RHCE (untagged)-Human Rh blood group, CcEe antigens (RHCE), transcript variant 2



  "NM_138618" in other vectors (6)

CNY 5,700.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit Polyclonal Anti-RHCE Antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms CD240CE; RH; Rh4; RH30A; RHC; RHCe(152N); RHE; RhIVb(J); RHIXB; RHNA; RHPI; RhVI; RhVIII
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC309558 representing NM_138618.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGAGCTCTAAGTACCCGCGGTCTGTCCGGCGCTGCCTGCCCCTCTGGGCCCTAACACTGGAAGCAGCT
CTCATTCTCCTCTTCTATTTTTTTACCCACTATGACGCTTCCTTAGAGGATCAAAAGGGGCTCGTGGCA
TCCTATCAAGTCGGCCAAGATCTGACCGTGATGGCGGCCCTTGGCTTGGGCTTCCTCACCTCAAATTTC
CGGAGACACAGCTGGAGCAGTGTGGCCTTCAACCTCTTCATGCTGGCGCTTGGTGTGCAGTGGGCAATC
CTGCTGGACGGCTTCCTGAGCCAGTTCCCTCCTGGGAAGGTGGTCATCACACTGTTCAGTATTCGGCTG
GCCACCATGAGTGCTATGTCGGTGCTGATCTCAGCGGGTGCTGTCTTGGGGAAGGTCAACTTGGCGCAG
TTGGTGGTGATGGTGCTGGTGGAGGTGACAGCTTTAGGCACCCTGAGGATGGTCATCAGTAATATCTTC
AACACAGACTACCACATGAACCTGAGGCACTTCTACGTGTTCGCAGCCTATTTTGGGCTGACTGTGGCC
TGGTGCCTGCCAAAGCCTCTACCCAAGGGAACGGAGGATAATGATCAGAGAGCAACGATACCCAGTTTG
TCTGCCATGCTGGGCGCCCTCTTCTTGTGGATGTTCTGGCCAAGTGTCAACTCTGCTCTGCTGAGAAGT
CCAATCCAAAGGAAGAATGCCATGTTCAACACCTACTATGCTCTAGCAGTCAGTGTGGTGACAGCCATC
TCAGGGTCATCCTTGGCTCACCCCCAAAGGAAGATCAGCATGACTTATGTGCACAGTGCGGTGTTGGCA
GGAGGCGTGGCTGTGGGTACCTCGTGTCACCTGATCCCTTCTCCGTGGCTTGCCATGGTGCTGGGTCTT
GTGGCTGGGCTGATCTCCATCGGGGGAGCCAAGTGCCTGCCGGATTGGCTTCCAGGTCCTCCTCAGCAT
TGGGGAACTCAGCTTGGCCATCGTGATAGCTCTCACGTCTGGTCTCCTGACAGGTTTGCTCCTAAATCT
CAAAATATGGAAAGCACCTCATGTGGCTAA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_138618
Insert Size 1065 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_138618.3
RefSeq Size 1484 bp
RefSeq ORF 1065 bp
Locus ID 6006
Protein Families Transmembrane
MW 38.7 kDa
Gene Summary The Rh blood group system is the second most clinically significant of the blood groups, second only to ABO. It is also the most polymorphic of the blood groups, with variations due to deletions, gene conversions, and missense mutations. The Rh blood group includes this gene which encodes both the RhC and RhE antigens on a single polypeptide and a second gene which encodes the RhD protein. The classification of Rh-positive and Rh-negative individuals is determined by the presence or absence of the highly immunogenic RhD protein on the surface of erythrocytes. A mutation in this gene results in amorph-type Rh-null disease. Alternative splicing of this gene results in multiple transcript variants encoding several different isoforms. [provided by RefSeq, Aug 2016]
Transcript Variant: This variant (2), also called Rh4, lacks one internal exon resulting in a frameshift and use of an upstream stop codon, as compared to variant 1. Isoform 2 is 63 aa shorter than isoform 1 and has a distinct C-terminus. Sequence Note:.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...