PML Protein (PML) (NM_033246) Human Untagged Clone

CAT#: SC309542

PML (untagged)-Human promyelocytic leukemia (PML), transcript variant 7



  "NM_033246" in other vectors (4)

CNY 6,840.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit monoclonal anti-PML antibody for SISCAPA, clone OTIR1H2
    • 100 ul

CNY 4,390.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms MYL; PP8675; RNF71; TRIM19
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC309542 representing NM_033246.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGAGCCTGCACCCGCCCGATCTCCGAGGCCCCAGCAGGACCCCGCCCGGCCCCAGGAGCCCACCATG
CCTCCCCCCGAGACCCCCTCTGAAGGCCGCCAGCCCAGCCCCAGCCCCAGCCCTACAGAGCGAGCCCCC
GCTTCGGAGGAGGAGTTCCAGTTTCTGCGCTGCCAGCAATGCCAGGCGGAAGCCAAGTGCCCGAAGCTG
CTGCCTTGTCTGCACACGCTGTGCTCAGGATGCCTGGAGGCGTCGGGCATGCAGTGCCCCATCTGCCAG
GCGCCCTGGCCCCTAGGTGCAGACACACCCGCCCTGGATAACGTCTTTTTCGAGAGTCTGCAGCGGCGC
CTGTCGGTGTACCGGCAGATTGTGGATGCGCAGGCTGTGTGCACCCGCTGCAAAGAGTCGGCCGACTTC
TGGTGCTTTGAGTGCGAGCAGCTCCTCTGCGCCAAGTGCTTCGAGGCACACCAGTGGTTCCTCAAGCAC
GAGGCCCGGCCCCTAGCAGAGCTGCGCAACCAGTCGGTGCGTGAGTTCCTGGACGGCACCCGCAAGACC
AACAACATCTTCTGCTCCAACCCCAACCACCGCACCCCTACGCTGACCAGCATCTACTGCCGAGGATGT
TCCAAGCCGCTGTGCTGCTCGTGCGCGCTCCTTGACAGCAGCCACAGTGAGCTCAAGTGCGACATCAGC
GCAGAGATCCAGCAGCGACAGGAGGAGCTGGACGCCATGACGCAGGCGCTGCAGGAGCAGGATAGTGCC
TTTGGCGCGGTTCACGCGCAGATGCACGCGGCCGTCGGCCAGCTGGGCCGCGCGCGTGCCGAGACCGAG
GAGCTGATCCGCGAGCGCGTGCGCCAGGTGGTAGCTCACGTGCGGGCTCAGGAGCGCGAGCTGCTGGAG
GCTGTGGACGCGCGGTACCAGCGCGACTACGAGGAGATGGCCAGTCGGCTGGGCCGCCTGGATGCTGTG
CTGCAGCGCATCCGCACGGGCAGCGCGCTGGTGCAGAGGATGAAGTGCTACGCCTCGGACCAGGAGGTG
CTGGACATGCACGGTTTCCTGCGCCAGGCGCTCTGCCGCCTGCGCCAGGAGGAGCCCCAGAGCCTGCAA
GCTGCCGTGCGCACCGATGGCTTCGACGAGTTCAAGGTGCGCCTGCAGGACCTCAGCTCTTGCATCACC
CAGGGGAAAGATGCAGCTGTATCCAAGAAAGCCAGCCCAGAGGCTGCCAGCACTCCCAGGGACCCTATT
GACGTTGACCTGAGGAACGCGTTGTGGTGA

AGCGGACCGACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGAT
ATCCTGGATTACAAGGATGACGACGATAAG
GTTTAA
Restriction Sites SgfI-RsrII     
ACCN NM_033246
Insert Size 1272 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_033246.2
RefSeq Size 1851 bp
RefSeq ORF 1272 bp
Locus ID 5371
UniProt ID P29590
Protein Families Druggable Genome, Transcription Factors
Protein Pathways Acute myeloid leukemia, Pathways in cancer, Ubiquitin mediated proteolysis
MW 47.6 kDa
Gene Summary The protein encoded by this gene is a member of the tripartite motif (TRIM) family. The TRIM motif includes three zinc-binding domains, a RING, a B-box type 1 and a B-box type 2, and a coiled-coil region. This phosphoprotein localizes to nuclear bodies where it functions as a transcription factor and tumor suppressor. Its expression is cell-cycle related and it regulates the p53 response to oncogenic signals. The gene is often involved in the translocation with the retinoic acid receptor alpha gene associated with acute promyelocytic leukemia (APL). Extensive alternative splicing of this gene results in several variations of the protein's central and C-terminal regions; all variants encode the same N-terminus. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (7) has multiple differences in the coding region compared to variant 1, one of which results in translational frame-shift. The resulting isoform (7, also known as PML-6B, PML-VIB, TRIM19eta and TRIM19iota) has a distinct C-terminus and is shorter than isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...