MAL (NM_022439) Human Untagged Clone

CAT#: SC309513

MAL (untagged)-Human mal, T-cell differentiation protein (MAL), transcript variant c



  "NM_022439" in other vectors (4)

CNY 3,990.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit Polyclonal Anti-MAL Antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms MVP17; VIP17
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_022439, the custom clone sequence may differ by one or more nucleotides
ATGGCCCCCGCAGCGGCGACGGGGGGCAGCACCCTGCCCAGTGGCTTCTCGGTCTTCACC
ACCTTGCCCGACTTGCTCTTCATCTTTGAGTTTGACGCAGCCTACCACTGCACCGCTGCC
CTCTTTTACCTCAGCGCCTCAGTCCTGGAGGCCCTGGCCACCATCACGATGCAAGACGGC
TTCACCTACAGGCACTACCATGAAAACATTGCTGCCGTGGTGTTCTCCTACATAGCCACT
CTGCTCTACGTGGTCCATGCGGTGTTCTCTTTAATCAGATGGAAGTCTTCATAA
Restriction Sites Please inquire     
ACCN NM_022439
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_022439.1, NP_071884.1
RefSeq Size 888 bp
RefSeq ORF 294 bp
Locus ID 4118
UniProt ID P21145
Protein Families Transmembrane
Gene Summary The protein encoded by this gene is a highly hydrophobic integral membrane protein belonging to the MAL family of proteolipids. The protein has been localized to the endoplasmic reticulum of T-cells and is a candidate linker protein in T-cell signal transduction. In addition, this proteolipid is localized in compact myelin of cells in the nervous system and has been implicated in myelin biogenesis and/or function. The protein plays a role in the formation, stabilization and maintenance of glycosphingolipid-enriched membrane microdomains. Down-regulation of this gene has been associated with a variety of human epithelial malignancies. Alternative splicing produces four transcript variants which vary from each other by the presence or absence of alternatively spliced exons 2 and 3. [provided by RefSeq, May 2012]
Transcript Variant: This variant (c) is missing alternatively spliced exon 2 but includes exon 3, resulting in isoform c which is shorter than the predominant isoform (a).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...