IL11RA (NM_147162) Human Untagged Clone

CAT#: SC309505

IL11RA (untagged)-Human interleukin 11 receptor, alpha (IL11RA), transcript variant 2



  "NM_147162" in other vectors (4)

CNY 6,370.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
IL-11 Receptor alpha Rabbit monoclonal Antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms CRSDA
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC309505 representing NM_147162.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGAGCAGCAGCTGCTCAGGGCTGAGCAGGGTCCTGGTGGCCGTGGCTACAGCCCTGGTGTCTGCCTCC
TCCCCCTGCCCCCAGGCCTGGGGCCCCCCAGGGGTCCAGTATGGGCAGCCAGGCAGGTCCGTGAAGCTG
TGTTGTCCTGGAGTGACTGCCGGGGACCCAGTGTCCTGGTTTCGGGATGGGGAGCCAAAGCTGCTCCAG
GGACCTGACTCTGGGCTAGGGCATGAACTGGTCCTGGCCCAGGCAGACAGCACTGATGAGGGCACCTAC
ATCTGCCAGACCCTGGATGGTGCACTTGGGGGCACAGTGACCCTGCAGCTGGGCTACCCTCCAGCCCGC
CCTGTTGTCTCCTGCCAAGCAGCCGACTATGAGAACTTCTCTTGCACTTGGAGTCCCAGCCAGATCAGC
GGTTTACCCACCCGCTACCTCACCTCCTACAGGAAGAAGACAGTCCTAGGAGCTGATAGCCAGAGGAGG
AGTCCATCCACAGGGCCCTGGCCATGCCCACAGGATCCCCTAGGGGCTGCCCGCTGTGTTGTCCACGGG
GCTGAGTTCTGGAGCCAGTACCGGATTAATGTGACTGAGGTGAACCCACTGGGTGCCAGCACACGCCTG
CTGGATGTGAGCTTGCAGAGCATCTTGCGCCCTGACCCACCCCAGGGCCTGCGGGTAGAGTCAGTACCA
GGTTACCCCCGACGCCTGCGAGCCAGCTGGACATACCCTGCCTCCTGGCCGTGCCAGCCCCACTTCCTG
CTCAAGTTCCGTTTGCAGTACCGTCCGGCGCAGCATCCAGCCTGGTCCACGGTGGAGCCAGCTGGACTG
GAGGAGGTGATCACAGATGCTGTGGCTGGGCTGCCCCATGCTGTACGAGTCAGTGCCCGGGACTTTCTA
GATGCTGGCACCTGGAGCACCTGGAGCCCGGAGGCCTGGGGAACTCCGAGCACTGGGACCATACCAAAG
GAGATACCAGCATGGGGCCAGCTACACACGCAGCCAGAGGTGGAGCCTCAGGTGGACAGCCCTGCTCCT
CCAAGGCCCTCCCTCCAACCACACCCTCGGCTACTTGATCACAGGGACTCTGTGGAGCAGGTAGCTGTG
CTGGCGTCTTTGGGAATCCTTTCTTTCCTGGGACTGGTGGCTGGGGCCCTGGCACTGGGGCTCTGGTAA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_147162
Insert Size 1173 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_147162.1
RefSeq Size 1458 bp
RefSeq ORF 1173 bp
Locus ID 3590
Protein Families Druggable Genome, Transmembrane
Protein Pathways Cytokine-cytokine receptor interaction, Hematopoietic cell lineage, Jak-STAT signaling pathway
MW 41.8 kDa
Gene Summary Interleukin 11 is a stromal cell-derived cytokine that belongs to a family of pleiotropic and redundant cytokines that use the gp130 transducing subunit in their high affinity receptors. This gene encodes the IL-11 receptor, which is a member of the hematopoietic cytokine receptor family. This particular receptor is very similar to ciliary neurotrophic factor, since both contain an extracellular region with a 2-domain structure composed of an immunoglobulin-like domain and a cytokine receptor-like domain. Multiple alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jun 2012]
Transcript Variant: This variant (2) skips a splice site utilized by variant 1 and immediately encounters a stop codon. The encoded isoform (2) is a shorter, truncated isoform compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...