United States
Germany
Japan
United Kingdom
China
BNIP1 (NM_013980) Human Untagged Clone
CAT＃: SC309457
BNIP1 (untagged)-Human BCL2/adenovirus E1B 19kDa interacting protein 1 (BNIP1), transcript variant BNIP1-c
CNY 3,990.00
Product images
CNY 1,999.00
CNY 2,700.00
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | NIP1; SEC20; TRG-8 |
| Vector | pCMV6 series |
| Sequence Data |
>NCBI ORF sequence for NM_013980, the custom clone sequence may differ by one or more nucleotides
ATGGCGGCTCCCCAAGACGTCCACGTCCGGATCTGTAACCAAGAGATTGTCAAATTTGAC CTGGAGGTGAAGGCGCTTATTCAGGATATCCGTGATTGTTCAGGACCCTTAAGTGCTCTT ACTGAACTGAATACTAAAGTAAAAGAGAAATTTCAACAGTTGCGTCACAGAATACAGCCA GTTCTCTATCAAAGGGCATTTATTTGGACTGCTTCCACATTTTTTTTTAAGCTAACTTAT TCCCTGACAGACTTTTCTTCAACTCAGCATGACTTCAACTCTCCAACTACACCTGTTACC TTCAGTGACCTGGAGCAGTTGGCTAAAGAGCAAGACAAAGAATCAGAGAAACAACTTCTA CTCCAGGAAGTGGAGAATCACAAAAAGCAGATGCTCAGGAAAACCACCAAAGAGAGCCTG GCCCAGACATCCAGTACCATCACTGAGAGCCTCATGGGGATCAGCAGGATGATGGCCCAG CAGGTCCAGCAGAGCGAGGAGGCCATGCAGTCTCTAGTCACTTCTTCACGAACGATCCTG GATGCAAATGAAGAATTTAAGTCCATGTCGGGCACCATCCAGCTGGGCCGGAAGCTTATC ACAAAATACAATCGCCGGGAGCTGACGGACAAGCTTCTCATCTTCCTTGCGCTAGCCCTG TTTCTTGCTACGGTCCTCTATATTGTGAAAAAGCGGCTCTTTCCATTTTTGTGA |
| Restriction Sites | Please inquire |
| ACCN | NM_013980 |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_013980.1, NP_053583.1 |
| RefSeq Size | 1145 bp |
| RefSeq ORF | 714 bp |
| Locus ID | 662 |
| UniProt ID | Q12981 |
| Protein Families | Druggable Genome, Transmembrane |
| Protein Pathways | SNARE interactions in vesicular transport |
| Gene Summary | This gene is a member of the BCL2/adenovirus E1B 19 kd-interacting protein (BNIP) family. It interacts with the E1B 19 kDa protein, which protects cells from virally-induced cell death. The encoded protein also interacts with E1B 19 kDa-like sequences of BCL2, another apoptotic protector. In addition, this protein is involved in vesicle transport into the endoplasmic reticulum. Alternative splicing of this gene results in four protein products with identical N- and C-termini. [provided by RefSeq, Mar 2011] Transcript Variant: Transcript variant BNIP1-c contains the same 129-nucleotide insertion as BNIP1-b, but also the same 102-nucleotide deletion as BNIP1-a. This variant lacks a BH3 domain which is associated with pro-apoptotic function, and therefore, may function similarly to anti-apoptotic members of the BCL2 family. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC214025 | BNIP1 (Myc-DDK-tagged)-Human BCL2/adenovirus E1B 19kDa interacting protein 1 (BNIP1), transcript variant BNIP1-c |
CNY 3,990.00 |
|
| RC214025L3 | Lenti-ORF clone of BNIP1 (Myc-DDK-tagged)-Human BCL2/adenovirus E1B 19kDa interacting protein 1 (BNIP1), transcript variant BNIP1-c |
CNY 5,890.00 |
|
| RC214025L4 | Lenti-ORF clone of BNIP1 (mGFP-tagged)-Human BCL2/adenovirus E1B 19kDa interacting protein 1 (BNIP1), transcript variant BNIP1-c |
CNY 5,890.00 |
|
| RG214025 | BNIP1 (tGFP-tagged) - Human BCL2/adenovirus E1B 19kDa interacting protein 1 (BNIP1), transcript variant BNIP1-c |
CNY 4,370.00 |
