ZNF124 (NM_003431) Human Untagged Clone

CAT#: SC309425

ZNF124 (untagged)-Human zinc finger protein 124 (ZNF124)



  "NM_003431" in other vectors (4)

CNY 6,270.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


Rabbit Polyclonal Anti-ZNF124 Antibody
    • 100 ul

CNY 5,250.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms HZF-16; HZF16; ZK7
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC309425 representing NM_003431.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGTCGGGACACCCCGGAAGCTGGGAAATGAACTCGGTTGCCTTTGAGGATGTGGCTGTGAACTTCACC
CAGGAGGAGTGGGCTTTGTTGGATCCTTCCCAGAAGAATCTCTATAGAGACGTGATGCAGGAAACCTTC
AGGAATCTGGCTTCCATAGGAAACAAAGGGGAAGACCAGAGCATTGAAGATCAGTACAAAAATTCTTCA
AGAAATCTAAGTTCATTTCAGATACATCAGAGAAATCACACTGGAGAGAAACCCTATGAATGTATGGAA
TGTGGGAAAGCCTTAGGTTTTTCCCGTTCTCTTAATAGACATAAAAGGATTCACACTGGAGAAAAACGC
TATGAATGTAAGCAATGTGGGAAAGCCTTCAGTCGTTCCAGTCACCTTCGTGACCATGAAAGAACTCAT
ACTGGAGAGAAACCCTATGAATGTAAGCACTGTGGGAAAGCCTTCCGTTACTCCAATTGCCTTCATTAC
CATGAAAGAACTCACACTGGAGAGAAACCTTATGTGTGCATGGAATGTGGCAAAGCTTTCAGTTGTCTC
AGTTCCTTGCAAGGACATATAAAGGCTCATGCTGGTGAAGAACCCTATCCATGTAAGCAATGTGGGAAA
GCCTTCAGATACGCCAGTTCCCTTCAGAAACACGAGAAAACTCATATTGCACAGAAACCCTATGTATGT
AACAATTGTGGTAAAGGCTTCAGATGTTCCAGTTCCCTTCGTGACCATGAAAGGACTCATACTGGAGAG
AAACCCTATGAATGTCAGAAATGTGGCAAAGCCTTTAGTCGTGCTAGTACCCTTTGGAAGCATAAAAAA
ACTCATACTGGAGAAAAGCCCTATAAATGTAAAAAAATGTAA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_003431
Insert Size 870 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_003431.3
RefSeq Size 2605 bp
RefSeq ORF 870 bp
Locus ID 7678
UniProt ID Q15973
MW 33.3 kDa
Gene Summary This gene encodes a protein with an amino-terminal KRAB-A box and multiple repeated Kruppel-type (C2H2) zinc finger motifs at its carboxy terminus. The encoded protein may function as a transcription factor. Expression of this gene is increased after vascular endothelial growth factor (VEGF) stimulation in human leukemia cell lines and results in inhibition of apoptotic cell death induced by irradiation or exposure to etoposide. Alternative splicing results in multiple transcript variants encoding distinct proteins. [provided by RefSeq, Jul 2014]
Transcript Variant: This variant (1) encodes isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...