HFE (NM_139009) Human Untagged Clone

CAT#: SC309414

HFE (untagged)-Human hemochromatosis (HFE), transcript variant 9



  "NM_139009" in other vectors (4)

CNY 6,270.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


Rabbit Polyclonal Anti-HFE Antibody
    • 50 ug

CNY 4,628.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms HFE1; HH; HLA-H; MVCD7; TFQTL2
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_139009, the custom clone sequence may differ by one or more nucleotides
ATGGGCCCGCGAGCCAGGCCGGCGCTTCTCCTCCTGATGCTTTTGCAGACCGCGGTCCTG
CAGGGGCGCTTGCTGCCTTTGGGCTACGTGGATGACCAGCTGTTCGTGTTCTATGATCAT
GAGAGTCGCCGTGTGGAGCCCCGAACTCCATGGGTTTCCAGTAGAATTTCAAGCCAGATG
TGGCTGCAGCTGAGTCAGAGTCTGAAAGGGTGGGATCACATGTTCACTGTTGACTTCTGG
ACTATTATGGAAAATCACAACCACAGCAAGGAGTCCCACACCCTGCAGGTCATCCTGGGC
TGTGAAATGCAAGAAGACAACAGTACCGAGGGCTACTGGAAGTACGGGTATGATGGGCAG
GACCACCTTGAATTCTGCCCTGACACACTGGATTGGAGAGCAGCAGAACCCAGGGCCTGG
CCCACCAAGCTGGAGTGGGAAAGGCACAAGATTCGGGCCAGGCAGAACAGGGCCTACCTG
GAGAGGGACTGCCCTGCACAGCTGCAGCAGTTGCTGGAGCTGGGGAGAGGTGTTTTGGAC
CAACAAGTGCCTCCTTTGGTGAAGGTGACACATCATGTGACCTCTTCAGTGACCACTCTA
CGGTGTCGGGCCTTGAACTACTACCCCCAGAACATCACCATGAAGTGGCTGAAGGATAAG
CAGCCAATGGATGCCAAGGAGTTCGAACCTAAAGACGTATTGCCCAATGGGGATGGGACC
TACCAGGGCTGGATAACCTTGGCTGTACCCCCTGGGGAAGAGCAGAGATATACGTGCCAG
GTGGAGCACCCAGGCCTGGATCAGCCCCTCATTGTGATCTGGGAGCCCTCACCGTCTGGC
ACCCTAGTCATTGGAGTCATCAGTGGAATTGCTGTTTTTGTCGTCATCTTGTTCATTGGA
ATTTTGTTCATAATATTAAGGAAGAGGCAGGGTTCAAGAGGAGCCATGGGGCACTACGTC
TTAGCTGAACGTGAGTGA
Restriction Sites Please inquire     
ACCN NM_139009
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_139009.1, NP_620578.1
RefSeq Size 1280 bp
RefSeq ORF 978 bp
Locus ID 3077
UniProt ID Q30201
Protein Families Druggable Genome, Transmembrane
Gene Summary The protein encoded by this gene is a membrane protein that is similar to MHC class I-type proteins and associates with beta2-microglobulin (beta2M). It is thought that this protein functions to regulate iron absorption by regulating the interaction of the transferrin receptor with transferrin. The iron storage disorder, hereditary haemochromatosis, is a recessive genetic disorder that results from defects in this gene. At least nine alternatively spliced variants have been described for this gene. Additional variants have been found but their full-length nature has not been determined. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (9) lacks an internal in-frame segment of the coding region through the use of an alternate splice acceptor site, as compared to variant 1, resulting in a shorter protein (isoform 9).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...