United States
Germany
Japan
United Kingdom
China
CIP29 (SARNP) (NM_033082) Human Untagged Clone
CAT＃: SC309293
SARNP (untagged)-Human SAP domain containing ribonucleoprotein (SARNP), transcript variant 1
CNY 2,400.00
CNY 3,990.00
| Cited in 2 publications. |
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | CIP29; HCC1; HSPC316; THO1 |
| Vector | pCMV6-XL5 |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | None |
| Sequence Data |
>NCBI ORF sequence for NM_033082, the custom clone sequence may differ by one or more nucleotides
GGGTAACAAGATGGCGACCGAGACGGTGGAGCTCCATAAGCTAAAGCTTGCCGAACTAAAGCAAGAATGT CTTGCTCGTGGTTTGGAGACCAAGGGAATAAAGCAAGATCTTATCCACAGACTCCAGGCATATCTTGAAG AACATGCTGAAGAGGAGGCAAATGAAGAAGATGTACTGGGAGATGAAACAGAGGAAGAAGAAACAAAGCC CATTGAGCTCCCTGTCAAAGAGGAAGAACCCCCTGAAAAAACTGTTGATGTGGCAGCAGAGAAGAAAGTG GTGAAAATTACATCTGAAATACCACAGACTGAGAGAATGCAGAAGAGGGCTGAACGATTCAATGTACCTG TGAGCTTGGAGAGTAAGAAAGCTGCTCGGGCAGCTAGGTTTGGGATTTCTTCAGTTCCAACAAAAGGTCT GTCATCTGATAACAAACCTATGGTTAACTTGGATAAGCTGAAGGAAAGAGCTCAAAGATTTGGTTTGAAT GTCTCTTCAATCTCCAGAAAGTCTGAAGATGATGAGAAACTGAAAAAGAGGAAGGAGCGATTTGGGATTG TCACAAGTTCAGCTGGAACTGGAACCACAGAGGATACAGAGGCAAAGAAGAGGAAAAGAGCAGAGCGCTT TGGGATTGCCTGATGAAAAGTTCCTGATACTTTCTGTTCTCCAGTGTTTTCCATTTCTCTCCTTCTTCTT GGTCACATATATGCCTAAATGCACAGTCATGTGCCTACGTCCTGCCTCGCAATGAGGGAGCATGTACCCC AGGTACATCCATGAACTGCGGCAGCAGTTTGACTTATTGCTGTTTCAGCTTTAAGGTTGTTGTGTTTTTG TTTTTGATTATGTTGCTTGTTAATAAAAAAAAA |
| Restriction Sites | Please inquire |
| ACCN | NM_033082 |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_033082.1, NP_149073.1 |
| RefSeq Size | 923 bp |
| RefSeq ORF | 633 bp |
| Locus ID | 84324 |
| UniProt ID | P82979 |
| Gene Summary | This gene encodes a protein that is upregulated in response to various cytokines. The encoded protein may play a role in cell cycle progression. A translocation between this gene and the myeloid/lymphoid leukemia gene, resulting in expression of a chimeric protein, has been associated with acute myelomonocytic leukemia. Pseudogenes exist on chromosomes 7 and 8. Alternatively spliced transcript variants have been described. [provided by RefSeq, Feb 2009] Transcript Variant: This variant (1) represents the shortest transcript and encodes the functional protein. |
Citations (2)
| The use of this cDNA Clones has been cited in the following citations: |
|---|
|
ATP is required for interactions between UAP56 and two conserved mRNA export proteins, Aly and CIP29, to assemble the TREX complex
,null,
Genes & Development
,PubMed ID 20844015
[SARNP]
|
|
ATP is required for interactions between UAP56 and two conserved mRNA export proteins, Aly and CIP29, to assemble the TREX complex
,Kobina Dufu, Michaela J. Livingstone, Jan Seebacher, Steven P. Gygi, Stuart A. Wilson, and Robin Reed,
Genes & Dev., Sep 2010; 24: 2043 - 2053
[SARNP]
|
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC203324 | SARNP (Myc-DDK-tagged)-Human SAP domain containing ribonucleoprotein (SARNP), transcript variant 1 |
CNY 2,400.00 |
|
| RC203324L1 | Lenti ORF clone of Human SAP domain containing ribonucleoprotein (SARNP), transcript variant 1, Myc-DDK-tagged |
CNY 4,800.00 |
|
| RC203324L2 | Lenti ORF clone of Human SAP domain containing ribonucleoprotein (SARNP), transcript variant 1, mGFP tagged |
CNY 5,890.00 |
|
| RC203324L3 | Lenti ORF clone of Human SAP domain containing ribonucleoprotein (SARNP), transcript variant 1, Myc-DDK-tagged |
CNY 5,890.00 |
|
| RC203324L4 | Lenti ORF clone of Human SAP domain containing ribonucleoprotein (SARNP), transcript variant 1, mGFP tagged |
CNY 5,890.00 |
|
| RG203324 | SARNP (tGFP-tagged) - Human SAP domain containing ribonucleoprotein (SARNP), transcript variant 1 |
CNY 4,000.00 |
|
| SC320821 | SARNP (untagged)-Human SAP domain containing ribonucleoprotein (SARNP), transcript variant 1 |
CNY 2,400.00 |
