KCNMB2 (NM_181361) Human Untagged Clone
CAT#: SC309268
KCNMB2 (untagged)-Human potassium large conductance calcium-activated channel, subfamily M, beta member 2 (KCNMB2), transcript variant 1
CNY 2,400.00
CNY 3,990.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Vector | pCMV6-AC |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>OriGene sequence for NM_005832.3
AGTATGAAGCAGCTTTAACGGAGCTCCAGATAACTAATTTCAAGCATGGCTGTCTAGCGT
GCCTGTCACTCCTATTGTCCTTCCAAACTCTTTCAGACATTTTGAGCAGGGAGTATTAAA GCTATGAGTTAGAAAGGGTTGTGACATTAATGGTCCACAAAGGCTTTAGGCACAAGAGGT AATGATGATTACCGGTGGCTATTTGGAGGACTGCACCGGATCGCTGTCATTAAAAATTAA GCGTGGCTTTTGAGGAAGATGTGACAACTACCGGAGGTCTTTTTGCCATTCCTCCAGGAC ATCCACCATAAGGAAAGGAGACCCTGGACCAACATTCTCTAAGATGTTTATATGGACCAG TGGCCGGACCTCTTCATCTTATAGACATGATGAAAAAAGAAATATTTACCAGAAAATCAG GGACCATGACCTCCTGGACAAAAGGAAAACAGTCACAGCACTGAAGGCAGGAGAGGACCG AGCTATTCTCCTGGGACTGGCTATGATGGTGTGCTCCATCATGATGTATTTTCTGCTGGG AATCACACTCCTGCGCTCATACATGCAGAGCGTGTGGACCGAAGAGTCTCAATGCACCTT GCTGAATGCGTCCATCACGGAAACATTTAACTGCTCCTTCAGCTGTGGTCCAGACTGCTG GAAACTTTCTCAGTACCCCTGCCTCCAGGTGTACGTTAACCTGACTTCTTCCGGGGAAAA GCTCCTCCTCTACCACACAGAAGAGACAATAAAAATCAATCAGAAGTGCTCCTATATACC TAAATGTGGAAAAAATTTTGAAGAATCCATGTCCCTGGTGAATGTTGTCATGGAAAACTT CAGGAAGTATCAACACTTCTCCTGCTATTCTGACCCAGAAGGAAACCAGAAGAGTGTTAT CCTAACCAAACTCTACAGTTCCAACGTGCTGTTCCATTCACTCTTCTGGCCAACCTGTAT GATGGCTGGGGGTGTGGCAATTGTTGCCATGGTGAAACTTACACAGTACCTCTCCCTACT ATGTGAGAGGATCCAACGGATCAATAGATAAATGCAAAAATGGATAAAATAATTTTTGTT AAAGCTCAAATACTGTTTTCTTTCATTCTTCACCAAAGAACCTTAAGTTTGTAACGTGCA GTCTGTTATGAGTTCCCTAATATATTCTTATATGTAGAGCAATAATGCAAAAGCTGTTCT ATATGCAAACATGATGTCTTTATTATTCAGGAGAATAAATAACTGTTTTGTGTCGAAAAA AAAAAAAAAAAAAAAAAAAAAAAAA |
Restriction Sites | Please inquire |
ACCN | NM_181361 |
Insert Size | 1300 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_181361.1, NP_852006.1 |
RefSeq Size | 2543 bp |
RefSeq ORF | 708 bp |
Locus ID | 10242 |
UniProt ID | Q9Y691 |
Protein Families | Druggable Genome, Ion Channels: Other, Transmembrane |
Protein Pathways | Vascular smooth muscle contraction |
Gene Summary | MaxiK channels are large conductance, voltage and calcium-sensitive potassium channels which are fundamental to the control of smooth muscle tone and neuronal excitability. MaxiK channels can be formed by 2 subunits: the pore-forming alpha subunit and the modulatory beta subunit. The protein encoded by this gene is an auxiliary beta subunit which decreases the activation time of MaxiK alpha subunit currents. Alternative splicing results in multiple transcript variants of this gene. Additional variants are discussed in the literature, but their full length nature has not been described. [provided by RefSeq, Jul 2013] Transcript Variant: This variant (1) represents the longest transcript. Variants 1, 2 and 3 encode the same protein. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC222841 | KCNMB2 (Myc-DDK-tagged)-Human potassium large conductance calcium-activated channel, subfamily M, beta member 2 (KCNMB2), transcript variant 1 |
CNY 2,400.00 |
|
RC222841L1 | Lenti ORF clone of Human potassium large conductance calcium-activated channel, subfamily M, beta member 2 (KCNMB2), transcript variant 1, Myc-DDK-tagged |
CNY 4,800.00 |
|
RC222841L2 | Lenti ORF clone of Human potassium large conductance calcium-activated channel, subfamily M, beta member 2 (KCNMB2), transcript variant 1, mGFP tagged |
CNY 5,890.00 |
|
RC222841L3 | Lenti ORF clone of Human potassium large conductance calcium-activated channel, subfamily M, beta member 2 (KCNMB2), transcript variant 1, Myc-DDK-tagged |
CNY 5,890.00 |
|
RC222841L4 | Lenti ORF clone of Human potassium large conductance calcium-activated channel, subfamily M, beta member 2 (KCNMB2), transcript variant 1, mGFP tagged |
CNY 5,890.00 |
|
RG222841 | KCNMB2 (tGFP-tagged) - Human potassium large conductance calcium-activated channel, subfamily M, beta member 2 (KCNMB2), transcript variant 1 |
CNY 4,370.00 |