Retinal protein 4 (UNC119) (NM_054035) Human Untagged Clone
CAT#: SC309075
UNC119 (untagged)-Human unc-119 homolog (C. elegans) (UNC119), transcript variant 2
CNY 3,990.00
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | HRG4; IMD13; POC7; POC7A |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC309075 representing NM_054035.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGAAGGTGAAGAAGGGCGGCGGTGGGGCCGGGACGGCGACGGAGTCCGCTCCGGGGCCCTCGGGCCAG AGCGTGGCCCCCATACCACAGCCGCCTGCGGAATCCGAATCTGGGTCCGAGTCGGAGCCGGACGCAGGC CCAGGGCCCAGGCCGGGGCCGCTGCAGAGGAAGCAGCCGATCGGGCCGGAGGACGTGCTGGGGCTGCAG CGGATCACCGGTGACTACCTCTGCTCCCCTGAGGAGAATATCTACAAGATCGACTTTGTCAGGTTTAAG ATTCGGGACATGGACTCAGGCACTGTCCTCTTTGAAATCAAGAAGCCCCCAGTCTCAGAACGGTTGCCC ATCAACCGGCGGGACCTGGACCCCAATGCTGGGCGCTTTGTCCGCTACCAGTTCACGCCTGCCTTCCTC CGCCTGAGGCAGGTGGGAGCCACGGTGGAGTTCACAGTGGGAGACAAGCCTGTCAACAACTTCCGCATG ATCGAGAGGCACTACTTCCGCAACCAGCTACTCAAAAGCTTCGACTTCCACTTTGGCTTCTGCATCCCC AGCAGCAAGAACACCTGCGAGCACATTTACGACTTCCCCCCTCTCTCCGAGGAGCTGAGTGCGCGGGCA GGGTCTTCTGGGAGTGGGGAAGTGGGGGCGTCTAGAGACTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_054035 |
Insert Size | 663 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_054035.2 |
RefSeq Size | 1665 bp |
RefSeq ORF | 663 bp |
Locus ID | 9094 |
UniProt ID | Q13432 |
Protein Families | Druggable Genome, Stem cell - Pluripotency |
MW | 24.1 kDa |
Gene Summary | This gene is specifically expressed in the photoreceptors in the retina. The encoded product shares strong homology with the C. elegans unc119 protein and it can functionally complement the C. elegans unc119 mutation. It has been localized to the photoreceptor synapses in the outer plexiform layer of the retina, and suggested to play a role in the mechanism of photoreceptor neurotransmitter release through the synaptic vesicle cycle. Two transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (2) has an additional segment in the 3' region compared to transcript variant 1. This results in a shorter isoform (b) with a distinct C-terminus compared to isoform a. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC212513 | UNC119 (Myc-DDK-tagged)-Human unc-119 homolog (C. elegans) (UNC119), transcript variant 2 |
CNY 2,400.00 |
|
RC212513L3 | Lenti ORF clone of Human unc-119 homolog (C. elegans) (UNC119), transcript variant 2, Myc-DDK-tagged |
CNY 5,890.00 |
|
RC212513L4 | Lenti ORF clone of Human unc-119 homolog (C. elegans) (UNC119), transcript variant 2, mGFP tagged |
CNY 5,890.00 |
|
RG212513 | UNC119 (tGFP-tagged) - Human unc-119 homolog (C. elegans) (UNC119), transcript variant 2 |
CNY 4,370.00 |
其它Retinal protein 4产品