Retinal protein 4 (UNC119) (NM_054035) Human Untagged Clone

CAT#: SC309075

UNC119 (untagged)-Human unc-119 homolog (C. elegans) (UNC119), transcript variant 2



  "NM_054035" in other vectors (4)

CNY 3,990.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms HRG4; IMD13; POC7; POC7A
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC309075 representing NM_054035.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGAAGGTGAAGAAGGGCGGCGGTGGGGCCGGGACGGCGACGGAGTCCGCTCCGGGGCCCTCGGGCCAG
AGCGTGGCCCCCATACCACAGCCGCCTGCGGAATCCGAATCTGGGTCCGAGTCGGAGCCGGACGCAGGC
CCAGGGCCCAGGCCGGGGCCGCTGCAGAGGAAGCAGCCGATCGGGCCGGAGGACGTGCTGGGGCTGCAG
CGGATCACCGGTGACTACCTCTGCTCCCCTGAGGAGAATATCTACAAGATCGACTTTGTCAGGTTTAAG
ATTCGGGACATGGACTCAGGCACTGTCCTCTTTGAAATCAAGAAGCCCCCAGTCTCAGAACGGTTGCCC
ATCAACCGGCGGGACCTGGACCCCAATGCTGGGCGCTTTGTCCGCTACCAGTTCACGCCTGCCTTCCTC
CGCCTGAGGCAGGTGGGAGCCACGGTGGAGTTCACAGTGGGAGACAAGCCTGTCAACAACTTCCGCATG
ATCGAGAGGCACTACTTCCGCAACCAGCTACTCAAAAGCTTCGACTTCCACTTTGGCTTCTGCATCCCC
AGCAGCAAGAACACCTGCGAGCACATTTACGACTTCCCCCCTCTCTCCGAGGAGCTGAGTGCGCGGGCA
GGGTCTTCTGGGAGTGGGGAAGTGGGGGCGTCTAGAGACTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_054035
Insert Size 663 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_054035.2
RefSeq Size 1665 bp
RefSeq ORF 663 bp
Locus ID 9094
UniProt ID Q13432
Protein Families Druggable Genome, Stem cell - Pluripotency
MW 24.1 kDa
Gene Summary This gene is specifically expressed in the photoreceptors in the retina. The encoded product shares strong homology with the C. elegans unc119 protein and it can functionally complement the C. elegans unc119 mutation. It has been localized to the photoreceptor synapses in the outer plexiform layer of the retina, and suggested to play a role in the mechanism of photoreceptor neurotransmitter release through the synaptic vesicle cycle. Two transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (2) has an additional segment in the 3' region compared to transcript variant 1. This results in a shorter isoform (b) with a distinct C-terminus compared to isoform a.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...