Parkin (PARK2) (NM_013988) Human Untagged Clone

CAT#: SC308936

PARK2 (untagged)-Human parkinson protein 2, E3 ubiquitin protein ligase (parkin) (PARK2), transcript variant 3



  "NM_013988" in other vectors (6)

CNY 6,270.00


货期*
4周

规格
    • 10 ug

Cited in 1 publication.

Product images

经常一起买 (3)
Rabbit polyclonal Parkin Antibody (C-term)
    • 400 ul

CNY 6,160.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms AR-JP; LPRS2; PARK2; PDJ
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC308936 representing NM_013988.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGATAGTGTTTGTCAGGTTCAACTCCAGCCATGGTTTCCCAGTGGAGGTCGATTCTGACACCAGCATC
TTCCAGCTCAAGGAGGTGGTTGCTAAGCGACAGGGGGTTCCGGCTGACCAGTTGCGTGTGATTTTCGCA
GGGAAGGAGCTGAGGAATGACTGGACTGTGCAGGAATTTTTCTTTAAATGTGGAGCACACCCCACCTCT
GACAAGGAAACATCAGTAGCTTTGCACCTGATCGCAACAAATAGTCGGAACATCACTTGCATTACGTGC
ACAGACGTCAGGAGCCCCGTCCTGGTTTTCCAGTGCAACTCCCGCCACGTGATTTGCTTAGACTGTTTC
CACTTATACTGTGTGACAAGACTCAATGATCGGCAGTTTGTTCACGACCCTCAACTTGGCTACTCCCTG
CCTTGTGTGGCTGGCTGTCCCAACTCCTTGATTAAAGAGCTCCATCACTTCAGGATTCTGGGAGAAGAG
CAGTACAACCGGTACCAGCAGTATGGTGCAGAGGAGTGTGTCCTGCAGATGGGGGGCGTGTTATGCCCC
CGCCCTGGCTGTGGAGCGGGGCTGCTGCCGGAGCCTGACCAGAGGAAAGTCACCTGCGAAGGGGGCAAT
GGCCTGGGCTGTGGGTTTGCCTTCTGCCGGGAATGTAAAGAAGCGTACCATGAAGGGGAGTGCAGTGCC
GTATTTGAAGCCTCAGGAACAACTACTCAGGCCTACAGAGTCGATGAAAGAGCCGCCGAGCAGGCTCGT
TGGGAAGCAGCCTCCAAAGAAACCATCAAGAAAACCACCAAGCCCTGTCCCCGCTGCCATGTACCAGTG
GAAAAAAATGGAGGCTGCATGCACATGAAGTGTCCGCAGCCCCAGTGCAGGCTCGAGTGGTGCTGGAAC
TGTGGCTGCGAGTGGAACCGCGTCTGCATGGGGGACCACTGGTTCGACGTGTAG

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_013988
Insert Size 951 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_013988.2
RefSeq Size 3626 bp
RefSeq ORF 951 bp
Locus ID 5071
UniProt ID O60260
Domains UBQ, IBR
Protein Pathways Parkinson's disease, Ubiquitin mediated proteolysis
MW 35.6 kDa
Gene Summary The precise function of this gene is unknown; however, the encoded protein is a component of a multiprotein E3 ubiquitin ligase complex that mediates the targeting of substrate proteins for proteasomal degradation. Mutations in this gene are known to cause Parkinson disease and autosomal recessive juvenile Parkinson disease. Alternative splicing of this gene produces multiple transcript variants encoding distinct isoforms. Additional splice variants of this gene have been described but currently lack transcript support. [provided by RefSeq, Jul 2008]
Transcript Variant: Transcript variant 3 lacks exons 3 to 5 present in the full-length transcript variant 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data because no single transcript was available for the full length of the gene. The extent of this transcript is supported by transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations (1)

Other Versions

Customer Reviews 
Loading...