H2AC7 (NM_021065) Human Untagged Clone

CAT#: SC308830

HIST1H2AD (untagged)-Human histone cluster 1, H2ad (HIST1H2AD)



  "NM_021065" in other vectors (4)

CNY 3,990.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms H2A.3; H2A/g; H2AFG; HIST1H2AD
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_021065, the custom clone sequence may differ by one or more nucleotides
ATGTCCGGACGCGGCAAGCAAGGCGGAAAGGCCCGAGCTAAGGCTAAGACCCGCTCTTCG
CGGGCCGGACTCCAGTTCCCTGTGGGCCGCGTACACCGCTTGCTCCGCAAGGGCAACTAC
TCCGAGCGAGTCGGGGCCGGCGCGCCAGTGTATCTGGCGGCGGTGTTGGAGTACCTGACC
GCCGAGATCCTGGAGCTGGCGGGCAACGCCGCCCGCGACAACAAGAAGACCCGCATCATC
CCCCGACACCTGCAGCTGGCCATCCGCAACGACGAGGAGCTAAACAAGTTGCTGGGTAAA
GTCACAATTGCTCAGGGCGGTGTTCTGCCCAACATCCAGGCTGTACTGCTCCCCAAGAAG
ACTGAGAGTCACCACAAGGCCAAGGGCAAGTAA
Restriction Sites Please inquire     
ACCN NM_021065
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_021065.2, NP_066409.1
RefSeq Size 460 bp
RefSeq ORF 393 bp
Locus ID 3013
UniProt ID P20671
Protein Pathways Systemic lupus erythematosus
Gene Summary Histones are basic nuclear proteins that are responsible for the nucleosome structure of the chromosomal fiber in eukaryotes. This structure consists of approximately 146 bp of DNA wrapped around a nucleosome, an octamer composed of pairs of each of the four core histones (H2A, H2B, H3, and H4). The chromatin fiber is further compacted through the interaction of a linker histone, H1, with the DNA between the nucleosomes to form higher order chromatin structures. This gene is intronless and encodes a replication-dependent histone that is a member of the histone H2A family. Transcripts from this gene lack polyA tails; instead, they contain a palindromic termination element. This gene is found in the large histone gene cluster on chromosome 6p22-p21.3. [provided by RefSeq, Aug 2015]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...