H2BC3 (NM_021062) Human Untagged Clone
CAT#: SC308827
HIST1H2BB (untagged)-Human histone cluster 1, H2bb (HIST1H2BB)
CNY 3,990.00
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | H2B.1; H2B/f; H2BFF; HIST1H2BB |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC308827 representing NM_021062.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGCCTGAACCCTCTAAGTCTGCTCCAGCCCCTAAAAAGGGTTCTAAGAAGGCTATCACTAAGGCGCAG AAGAAGGATGGTAAGAAGCGTAAGCGCAGCCGCAAGGAGAGCTATTCTATCTATGTGTACAAGGTTCTG AAGCAGGTCCACCCCGACACCGGCATCTCATCCAAGGCCATGGGGATCATGAATTCCTTCGTCAACGAC ATCTTCGAGCGCATCGCGGGCGAGGCTTCTCGCCTGGCTCACTACAATAAGCGCTCGACCATCACCTCC AGGGAGATTCAGACGGCTGTGCGCCTGCTGCTGCCTGGGGAGCTGGCTAAGCATGCTGTGTCCGAGGGC ACTAAGGCAGTTACCAAGTACACTAGCTCTAAATAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_021062 |
Insert Size | 381 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_021062.2 |
RefSeq Size | 431 bp |
RefSeq ORF | 381 bp |
Locus ID | 3018 |
UniProt ID | P33778 |
Protein Pathways | Systemic lupus erythematosus |
MW | 14 kDa |
Gene Summary | Histones are basic nuclear proteins that are responsible for the nucleosome structure of the chromosomal fiber in eukaryotes. Nucleosomes consist of approximately 146 bp of DNA wrapped around a histone octamer composed of pairs of each of the four core histones (H2A, H2B, H3, and H4). The chromatin fiber is further compacted through the interaction of a linker histone, H1, with the DNA between the nucleosomes to form higher order chromatin structures. This gene is intronless and encodes a replication-dependent histone that is a member of the histone H2B family. Transcripts from this gene lack polyA tails; instead, they contain a palindromic termination element. This gene is found in the large histone gene cluster on chromosome 6p22-p21.3. [provided by RefSeq, Aug 2015] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC220710 | HIST1H2BB (Myc-DDK-tagged)-Human histone cluster 1, H2bb (HIST1H2BB) |
CNY 1,200.00 |
|
RC220710L3 | Lenti ORF clone of Human histone cluster 1, H2bb (HIST1H2BB), Myc-DDK-tagged |
CNY 5,890.00 |
|
RC220710L4 | Lenti ORF clone of Human histone cluster 1, H2bb (HIST1H2BB), mGFP tagged |
CNY 3,600.00 |
|
RG220710 | HIST1H2BB (tGFP-tagged) - Human histone cluster 1, H2bb (HIST1H2BB) |
CNY 2,800.00 |