United States
Germany
Japan
United Kingdom
China
ICAD (DFFA) (NM_213566) Human Untagged Clone
CAT＃: SC308657
DFFA (untagged)-Human DNA fragmentation factor, 45kDa, alpha polypeptide (DFFA), transcript variant 2
CNY 6,270.00
Product images
CNY 1,999.00
CNY 2,700.00
热销推荐Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | DFF-45; DFF1; ICAD |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>SC308657 representing NM_213566.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGGAGGTGACCGGGGACGCCGGGGTACCAGAATCTGGCGAGATCCGGACTCTAAAGCCGTGTCTGCTG CGCCGCAACTACAGCCGCGAACAGCACGGCGTGGCCGCCTCCTGCCTCGAAGACCTGAGGAGCAAGGCC TGTGACATTCTGGCCATTGATAAGTCCCTGACACCAGTCACCCTGGTCCTGGCAGAGGATGGCACCATA GTGGATGATGACGATTACTTTCTGTGTCTACCTTCCAATACTAAGTTTGTGGCATTGGCTAGTAATGAG AAATGGGCATACAACAATTCAGATGGAGGTACAGCTTGGATTTCCCAAGAGTCCTTTGATGTAGATGAA ACAGACAGCGGGGCAGGGTTGAAGTGGAAGAATGTGGCCAGGCAGCTGAAAGAAGATCTGTCCAGCATC ATCCTCCTATCAGAGGAGGACCTCCAGATGCTTGTTGACGCTCCCTGCTCAGACCTGGCTCAGGAACTA CGTCAGAGTTGTGCCACCGTCCAGCGGCTGCAGCACACACTCCAACAGGTGCTTGACCAAAGAGAGGAA GTGCGTCAGTCCAAGCAGCTCCTGCAGCTGTACCTCCAGGCTTTGGAGAAAGAGGGCAGCCTCTTGTCA AAGCAGGAAGAGTCCAAAGCTGCCTTTGGTGAGGAGGTGGATGCAGTAGACACGGGTATCAGCAGAGAG ACCTCCTCGGACGTTGCGCTGGCGAGCCACATCCTTACTGCACTGAGGGAGAAGCAGGCTCCAGAGCTG AGCTTATCTAGTCAGGATTTGGAGGTGGGCGGAAACCAGGGTCACTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_213566 |
| Insert Size | 807 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_213566.1 |
| RefSeq Size | 3408 bp |
| RefSeq ORF | 807 bp |
| Locus ID | 1676 |
| UniProt ID | O00273 |
| Protein Pathways | Apoptosis |
| MW | 29.4 kDa |
| Gene Summary | Apoptosis is a cell death process that removes toxic and/or useless cells during mammalian development. The apoptotic process is accompanied by shrinkage and fragmentation of the cells and nuclei and degradation of the chromosomal DNA into nucleosomal units. DNA fragmentation factor (DFF) is a heterodimeric protein of 40-kD (DFFB) and 45-kD (DFFA) subunits. DFFA is the substrate for caspase-3 and triggers DNA fragmentation during apoptosis. DFF becomes activated when DFFA is cleaved by caspase-3. The cleaved fragments of DFFA dissociate from DFFB, the active component of DFF. DFFB has been found to trigger both DNA fragmentation and chromatin condensation during apoptosis. Two alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (2) has an additional segment in the 3' region, as compared to variant 1. It encodes isoform 2 which has a shorter and distinct C-terminus, as compared to isoform 1. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC220837 | DFFA (Myc-DDK-tagged)-Human DNA fragmentation factor, 45kDa, alpha polypeptide (DFFA), transcript variant 2 |
CNY 2,400.00 |
|
| RC220837L3 | Lenti ORF clone of Human DNA fragmentation factor, 45kDa, alpha polypeptide (DFFA), transcript variant 2, Myc-DDK-tagged |
CNY 5,890.00 |
|
| RC220837L4 | Lenti ORF clone of Human DNA fragmentation factor, 45kDa, alpha polypeptide (DFFA), transcript variant 2, mGFP tagged |
CNY 5,890.00 |
|
| RG220837 | DFFA (tGFP-tagged) - Human DNA fragmentation factor, 45kDa, alpha polypeptide (DFFA), transcript variant 2 |
CNY 4,370.00 |
