C1QTNF8 (NM_207419) Human Untagged Clone
CAT#: SC308530
C1QTNF8 (untagged)-Human C1q and tumor necrosis factor related protein 8 (C1QTNF8)
CNY 3,990.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | CTRP8; UNQ5829 |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>OriGene sequence for NM_207419 edited
ATGGCAGCCCCCGCCCTGCTGCTCCTAGCACTGCTGCTGCCCGTGGGGGCCTGGCCCGGG CTGCCCAGGAGGCCCTGTGTGCACTGCTGCCGCCCGGCCTGGCCCCCTGGACCCTATGCC CGGGTGAGTGACAGGGACCTGTGGAGGGGGGACCTGTGGAGGGGGCTGCCTCGAGTACGG CCCACTATAGACATCGAAATCCTCAAAGGTGAGAAGGGTGAGGCCGGCGTCCGAGGTCGG GCCGGCAGGAGCGGGAAAGAGGGGCCGCCAGGCGCCCGGGGCCTGCAGGGCCGCAGAGGC CAGAAGGGGCAGGTGGGGCCGCCGGGCGCCGCGTGCCGACGTGCCTACGCCGCCTTCTCC GTGGGCCGGCGCGAGGGCCTGCACAGCTCCGACCACTTCCAGGCGGTGCCCTTCGACACG GAGCTGGTGAACCTGGACGGCGCCTTCGACCTGGCCGCGGGCCGCTTCCTCTGCACGGTG CCCGGCGTCTACTTCCTCAGCCTCAACGTGCACACCTGGAACTACAAGGAGACCTACCTG CACATCATGCTGAACCGGCGGCCCGCGGCCGTGCTCTACGCGCAGCCCAGCGAGCGCAGC GTCATGCAGGCCCAGAGCCTGATGCTGCTGCTGGCGGCGGGCGACGCCGTCTGGGTGCGC ATGTTCCAGCGCGACCGGGACAACGCCATCTACGGCGAGCACGGAGACCTCTACATCACC TTCAGCGGCCACCTGGTCAAGCCGGCCGCCGAGCTGTAGTCTAGA |
Restriction Sites | Please inquire |
ACCN | NM_207419 |
Insert Size | 800 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | The open reading frame of this TrueClone was fully sequenced and found to be a perfect match to the protein associated to this reference. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_207419.2, NP_997302.2 |
RefSeq Size | 2974 bp |
RefSeq ORF | 759 bp |
Locus ID | 390664 |
UniProt ID | P60827 |
Protein Families | Secreted Protein |
Gene Summary | May play a role as ligand of RXFP1.[UniProtKB/Swiss-Prot Function] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC211649 | C1QTNF8 (Myc-DDK-tagged)-Human C1q and tumor necrosis factor related protein 8 (C1QTNF8) |
CNY 2,400.00 |
|
RC211649L3 | Lenti ORF clone of Human C1q and tumor necrosis factor related protein 8 (C1QTNF8), Myc-DDK-tagged |
CNY 5,890.00 |
|
RC211649L4 | Lenti ORF clone of Human C1q and tumor necrosis factor related protein 8 (C1QTNF8), mGFP tagged |
CNY 5,890.00 |
|
RG211649 | C1QTNF8 (tGFP-tagged) - Human C1q and tumor necrosis factor related protein 8 (C1QTNF8) |
CNY 4,000.00 |
其它C1QTNF8产品