NPSR1 (NM_207173) Human Untagged Clone
CAT#: SC308405
NPSR1 (untagged)-Human neuropeptide S receptor 1 (NPSR1), transcript variant 2
CNY 3,656.00
CNY 7,220.00
Cited in 1 publication. |
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | ASRT2; GPR154; GPRA; NPSR; PGR14; VRR1 |
Vector | pCMV6-XL6 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>OriGene sequence for NM_207173 edited
TCAGCTGCAGGAGCAAGGACAGTGAGGCTCAACCCCGCCTGAGCCATGCCAGCCAACTTC ACAGAGGGCAGCTTCGATTCCAGTGGGACCGGGCAGACGCTGGATTCTTCCCCAGTGGCT TGCACTGAAACAGTGACTTTTACTGAAGTGGTGGAAGGAAAGGAATGGGGTTCCTTCTAC TACTCCTTTAAGACTGAGCAATTGATAACTCTGTGGGTCCTCTTTGTTTTTACCATTGTT GGAAACTCCGTTGTGCTTTTTTCCACATGGAGGAGAAAGAAGAAGTCAAGAATGACCTTC TTTGTGACTCAGCTGGCCATCACAGATTCTTTCACAGGACTGGTCAACATCTTGACAGAT ATTAATTGGCGATTCACTGGAGACTTCACGGCACCTGACCTGGTTTGCCGAGTGGTCCGC TATTTGCAGGTTGTGCTGCTCTACGCCTCTACCTACGTCCTGGTGTCCCTCAGCATAGAC AGATACCATGCCATCGTCTACCCCATGAAGTTCCTTCAAGGAGAAAAGCAAGCCAGGGTC CTCATTGTGATCGCCTGGAGCCTGTCTTTTCTGTTCTCCATTCCCACCCTGATCATATTT GGGAAGAGGACACTGTCCAACGGTGAAGTGCAGTGCTGGGCCCTGTGGCCTGACGACTCC TACTGGACCCCATACATGACCATCGTGGCCTTCCTGGTGTACTTCATCCCTCTGACAATC ATCAGCATCATGTATGGCATTGTGATCCGAACTATTTGGATTAAAAGCAAAACCTACGAA ACAGTGATTTCCAACTGCTCAGATGGGAAACTGTGCAGCAGCTATAACCGAGGACTCATC TCAAAGGCAAAAATCAAGGCTATCAAGTATAGCATCATCATCATTCTTGCCTTCATCTGC TGTTGGAGTCCATACTTCCTGTTTGACATTTTGGACAATTTCAACCTCCTTCCAGACACC CAGGAGCGTTTCTATGCCTCTGTGATCATTCAGAACCTGCCAGCATTGAATAGTGCCATC AACCCCCTCATCTACTGTGTCTTCAGCAGCTCCATCTCTTTCCCCTGCAGGGTCATCCGT CTCCGTCAGCTCCAGGAGGCTGCGCTAATGCTCTGCCCTCAACGAGAGAACTGGAAGGGT ACTTGGCCAGGTGTACCTTCCTGGGCTCTTCCAAGGTGACAGCTCTCACCCTGTGCTGCA GGTGGCCCTGTGCCTGGTGCCACTTCTCACTGCTTACCAGGGCACAAGGA |
Restriction Sites | Please inquire |
ACCN | NM_207173 |
Insert Size | 1300 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | The ORF of this clone is found to be a perfect match to the ORF of the RefSeq sequence, NM_207173.1. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_207173.1, NP_997056.1 |
RefSeq Size | 1410 bp |
RefSeq ORF | 1134 bp |
Locus ID | 387129 |
UniProt ID | Q6W5P4 |
Protein Families | Druggable Genome, Transmembrane |
Gene Summary | This gene encodes a member of the vasopressin/oxytocin subfamily of G protein-coupled receptors. The encoded membrane protein acts as a receptor for neuropeptide S and affects a variety of cellular processes through its signaling. Increased expression of this gene in ciliated cells of the respiratory epithelium and in bronchial smooth muscle cells is associated with asthma. Polymorphisms in this gene have also been associated with asthma susceptibility, panic disorders, inflammatory bowel disease, and rheumatoid arthritis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014] Transcript Variant: This variant (2) uses an alternate 3' terminal exon, compared to variant 1. The encoded isoform (B, PMID: 15947423) has a longer and distinct C-terminus, compared to isoform A. |
Citations (1)
The use of this cDNA Clones has been cited in the following citations: |
---|
A Single-Nucleotide Polymorphism of Human Neuropeptide S Gene Originated from Europe Shows Decreased Bioactivity
,Deng, C;He, X;Hsueh, AJW;,
PLOS ONE Dec 2013.
[NPSR1]
|
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC221361 | NPSR1 (Myc-DDK-tagged)-Human neuropeptide S receptor 1 (NPSR1), transcript variant 2 |
CNY 3,656.00 |
|
RC221361L1 | Lenti ORF clone of Human neuropeptide S receptor 1 (NPSR1), transcript variant 2, Myc-DDK-tagged |
CNY 6,056.00 |
|
RC221361L2 | Lenti ORF clone of Human neuropeptide S receptor 1 (NPSR1), transcript variant 2, mGFP tagged |
CNY 5,890.00 |
|
RC221361L3 | Lenti ORF clone of Human neuropeptide S receptor 1 (NPSR1), transcript variant 2, Myc-DDK-tagged |
CNY 5,890.00 |
|
RC221361L4 | Lenti ORF clone of Human neuropeptide S receptor 1 (NPSR1), transcript variant 2, mGFP tagged |
CNY 5,890.00 |
|
RG221361 | NPSR1 (tGFP-tagged) - Human neuropeptide S receptor 1 (NPSR1), transcript variant 2 |
CNY 5,256.00 |